Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Brassica napus male sterile gene BnMS5e, cDNA, protein, vector, engineering bacterium and application thereof

A technology for male sterility gene and Brassica napus, which can be used in genetic engineering, application, plant genetic improvement and other directions, and can solve problems such as pollen production

Pending Publication Date: 2021-01-26
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, neither BnMS5 b Or BnMS5 d The resulting male sterility of rapeseed is affected by temperature, and pollen is produced under low temperature conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus male sterile gene BnMS5e, cDNA, protein, vector, engineering bacterium and application thereof
  • Brassica napus male sterile gene BnMS5e, cDNA, protein, vector, engineering bacterium and application thereof
  • Brassica napus male sterile gene BnMS5e, cDNA, protein, vector, engineering bacterium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Analysis on Genetic Rule of Nuclear Dominant Sterile Material of Brassica napus

[0035] 1. Experimental materials

[0036] The material used in this experiment is 8029AB, a two-type nuclear dominant line of Brassica napus, in which the sterile strain is called 8029A (preserved in the China Collection and Culture Collection Center, the preservation number is: CCTCC NO: P202006), and the fertile strain is called 8029B (Preserved in the China Collection and Culture Collection Center, the preservation number is: CCTCC NO: P202007), 8029AB comes from the Institute of Oil Crops, Chinese Academy of Agricultural Sciences. Rapeseed napus nuclear dominant two-type line 8029A Material source: M 2 Three sterile individual plants were obtained from B. napus, and the sterile individual plants were crossed with Brassica napus Zhongshuang 11, and Zhongshuang 11 was used as a recurrent parent to backcross to obtain a near-isogenic line. After different temperature treatments at the f...

Embodiment 2

[0042] Brassica napus Dominant Nuclear Sterile Gene BnMS5 e with BnMS5 d Allelic analysis of

[0043] Zeng et al. (2014) discovered the thermosensitive nuclear male sterile line TE5A in Brassica napus, and cloned the sterile gene BnMS5 by map-based cloning technology d . To verify whether the 8029A sterility gene is related to BnMS5 d Gene alleles, we use the homozygous 8029A sterile line and the homozygous TE5A (genotype BnMS5 d BnMS5 d ) to get F 1 . Will F 1 Planted in the greenhouse, keep a stable temperature of 25°C during the flowering period, and observe the F 1 Plant fertility, F 1 All showed complete infertility. Use F 1 The sterile plant was used as the female parent, and the maintainer Zhongshuang 11 was used as the male parent to cross, and BC was harvested 1 seed. Will BC 1 Planted in a greenhouse, kept at a stable temperature of 25°C during the flowering period, surveyed 200 BC plants after flowering 1 group sports, the results show that BC 1 All ...

Embodiment 3

[0047] Brassica napus Dominant Nuclear Sterility Gene BnMS5 e functional verification of

[0048] 1. BnMS5 e Rapeseed Transgenic Experiment

[0049]In this example, the plant expression vector pCAMBIA2300 was used as the transgenic vector of Brassica napus. The vector encodes a bacterial origin of replication (ori), a kanamycin resistance gene (Kan'), a CaMV35S promoter, a terminator for the NOS gene, and a restriction enzyme multiple cloning site. By analyzing the relationship between the restriction site of the BAC clone sequence carrying the candidate gene and the candidate gene, it was amplified using primers ZT-1L, ZT-1R and high-fidelity PCR technology (PhusionTM High-Fidelity DNAPolymerse, from New England Biolads Company) A 3.951 kb fragment, ZT-1L (forward primer): CCGGAATTCCTATTAATAAATTAATGACTCAGCT (SEQ ID NO. 4); ZT-1R (reverse primer): CAACTGCAGCCAAGAAGAGAATTGATTCCACA (SEQ ID NO. 5). This fragment contains Ecol I and Pst I restriction sites. The fragments incl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a brassica napus male sterile gene BnMS5e, cDNA, protein, a vector, an engineering bacterium and application thereof, and belongs to the technical field of biological breeding. The nucleotide sequence of the gene is as shown in SEQ ID NO.1. Function deletion of the gene BnMS5e can seriously influence the behavior of chromosomes in the meiosis process of male gametes, and finally causes microspore development defects. The mutant combining a maintainer line and a restorer line can be applied to culture of new rape hybrid varieties. The gene BnMS5e serving as a functionalgene for regulating and controlling oilseed rape meiosis can be applied to creation of an oilseed rape genetic engineering male sterile system.

Description

technical field [0001] The invention relates to the technical field of biological breeding, in particular to a Brassica napus male sterility gene BnMS5e, cDNA, protein, carrier, engineering bacteria and application thereof. Background technique [0002] At present, the male sterility systems used in rapeseed heterosis in my country are mainly cytoplasmic male sterile system and nuclear male sterile system, but the application of cytoplasmic male sterile system in rapeseed production has some unsatisfactory aspects. However, the sterility of the nuclear male sterility system is stable and complete, and there is no potential risk of sterile cytoplasmic negative effects and cytoplasmic simplification. It is generally not limited by the restoration relationship, and it is easy to obtain strong dominant combinations. In the use of heterosis Has broad prospects. In recent years, my country has continuously made breakthroughs in the field of rapeseed male sterility research. The d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00A01H6/20
CPCC07K14/415C12N15/8289
Inventor 曾新华吴刚闫晓红袁荣王淼刘芳罗军玲武玉花朱莉李晓飞李均
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com