Brassica napus male sterile gene BnMS5e, cDNA, protein, vector, engineering bacterium and application thereof
A technology for male sterility gene and Brassica napus, which can be used in genetic engineering, application, plant genetic improvement and other directions, and can solve problems such as pollen production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Analysis on Genetic Rule of Nuclear Dominant Sterile Material of Brassica napus
[0035] 1. Experimental materials
[0036] The material used in this experiment is 8029AB, a two-type nuclear dominant line of Brassica napus, in which the sterile strain is called 8029A (preserved in the China Collection and Culture Collection Center, the preservation number is: CCTCC NO: P202006), and the fertile strain is called 8029B (Preserved in the China Collection and Culture Collection Center, the preservation number is: CCTCC NO: P202007), 8029AB comes from the Institute of Oil Crops, Chinese Academy of Agricultural Sciences. Rapeseed napus nuclear dominant two-type line 8029A Material source: M 2 Three sterile individual plants were obtained from B. napus, and the sterile individual plants were crossed with Brassica napus Zhongshuang 11, and Zhongshuang 11 was used as a recurrent parent to backcross to obtain a near-isogenic line. After different temperature treatments at the f...
Embodiment 2
[0042] Brassica napus Dominant Nuclear Sterile Gene BnMS5 e with BnMS5 d Allelic analysis of
[0043] Zeng et al. (2014) discovered the thermosensitive nuclear male sterile line TE5A in Brassica napus, and cloned the sterile gene BnMS5 by map-based cloning technology d . To verify whether the 8029A sterility gene is related to BnMS5 d Gene alleles, we use the homozygous 8029A sterile line and the homozygous TE5A (genotype BnMS5 d BnMS5 d ) to get F 1 . Will F 1 Planted in the greenhouse, keep a stable temperature of 25°C during the flowering period, and observe the F 1 Plant fertility, F 1 All showed complete infertility. Use F 1 The sterile plant was used as the female parent, and the maintainer Zhongshuang 11 was used as the male parent to cross, and BC was harvested 1 seed. Will BC 1 Planted in a greenhouse, kept at a stable temperature of 25°C during the flowering period, surveyed 200 BC plants after flowering 1 group sports, the results show that BC 1 All ...
Embodiment 3
[0047] Brassica napus Dominant Nuclear Sterility Gene BnMS5 e functional verification of
[0048] 1. BnMS5 e Rapeseed Transgenic Experiment
[0049]In this example, the plant expression vector pCAMBIA2300 was used as the transgenic vector of Brassica napus. The vector encodes a bacterial origin of replication (ori), a kanamycin resistance gene (Kan'), a CaMV35S promoter, a terminator for the NOS gene, and a restriction enzyme multiple cloning site. By analyzing the relationship between the restriction site of the BAC clone sequence carrying the candidate gene and the candidate gene, it was amplified using primers ZT-1L, ZT-1R and high-fidelity PCR technology (PhusionTM High-Fidelity DNAPolymerse, from New England Biolads Company) A 3.951 kb fragment, ZT-1L (forward primer): CCGGAATTCCTATTAATAAATTAATGACTCAGCT (SEQ ID NO. 4); ZT-1R (reverse primer): CAACTGCAGCCAAGAAGAGAATTGATTCCACA (SEQ ID NO. 5). This fragment contains Ecol I and Pst I restriction sites. The fragments incl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



