Catalase with high enzyme activity, gene, recombinant strain with high catalase yield and application
A catalase and recombinant strain technology, applied in the field of genetic engineering, can solve the problems of enzyme separation, complex purification, high yield and inconvenient extraction, and achieve the effect of efficient production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Embodiment 1, fungus Rasamsonia sp. catalase CatR gene cloning
[0067] 1. Fungus Rasamsonia sp. catalase CatR gene synthesis.
[0068] Soil samples of the fungus Rasamsonia sp. strain from Zhuhai, China were passed through the dilution plate, and a small amount of catalase activity was detected from the screening plate. After the morphological characteristics and ITS rDNA sequence, the strain was identified as Rasamsonia sp. Using primers CatR-F, CatR-R to amplify the catalase gene fragment. Its nucleotide sequence is SEQ ID NO: 2, and its coded amino acid sequence is SEQ ID NO: 1.
[0069] PCR primers and reaction conditions are as follows:
[0070] CatR-F(5'-3'): ATGCGCGCTGTGCAACTTCTGCCCAGC
[0071] CatR-R (5'-3'): TCATTACTCATCCAGCGCAAACCGGTCGAGGAAC
[0072] Reaction conditions:
[0073] Table 1
[0074]
[0075] PCR amplification was carried out with the above primers to obtain a DNA band with a size of about 2.2 kb, and the target fragment was recovered. ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com