Optimized fermentation method of saccharopolyspora erythraea with sucC gene knocked out

A red Saccharopolyspora, gene knockout technology, applied in the field of fermentation engineering, can solve the problems of high cost, low yield, low effective components, etc.

Pending Publication Date: 2021-03-26
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In summary, although erythromycin biofermentation has made some progress, there are still high requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized fermentation method of saccharopolyspora erythraea with sucC gene knocked out
  • Optimized fermentation method of saccharopolyspora erythraea with sucC gene knocked out
  • Optimized fermentation method of saccharopolyspora erythraea with sucC gene knocked out

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, the preparation of E3-△sucC genetically engineered bacteria

[0047] The industrial strain S. erythraea E3 strain (obtained from Shanghai Guojia Biochemical Engineering Technology Research Center Co., Ltd.) was used as the starting strain to prepare a genetically engineered strain for knocking out the succinyl-CoA synthetase gene (SucC).

[0048] The SucC gene was knocked out by insertional inactivation, and primers were designed during the insertional inactivation process to amplify a fragment of 1021 bp in length from 196 bp to 1216 bp behind the start codon of the SucC gene.

[0049] The primer sequences are as follows:

[0050] Upstream primers:

[0051] CCCAAGCTTGGGATGAGGCCAAGACGAA (SEQ ID NO: 1);

[0052] Downstream primers:

[0053] GAAGATCTTCGCCCTGGACGATGACCTTG (SEQ ID NO: 2).

[0054] The genome of the S. erythraea E3 strain was used as a template, and the above primers were used to amplify to obtain the target fragment, which was 1021 bp in l...

Embodiment 2

[0056] Embodiment 2, basic culture

[0057] 1. Plate seed culture

[0058] Prepare the flat seed medium according to the required amount, adjust the pH to 7.0 before sterilization, and then autoclave it together with the flat bamboo stick wrapped in kraft paper at 121°C for 30 minutes, and then place it on the ultra-clean workbench. The sterilized media is aliquoted into plates. Before inverting the plate, the temperature of the plate culture dish did not exceed 60°C, and the antibiotics Apra (concentration of 50 μg / ml) and thiostreptomycin (concentration of 100 μg / ml) were added.

[0059] After the plate is solidified, use an inoculation loop to dip the strains from the preserved glycerin tube, draw a line on the plate, and finally seal the plate with a parafilm, and place it in a constant temperature incubator at 35°C for one week until more obvious bacteria appear on the plate. Pale spores.

[0060] 2. Shake flask seed culture

[0061] Prepare 45ml of shake flask seed m...

Embodiment 3

[0068] Embodiment 3, culture process optimization

[0069] According to the growth of the E3-ΔsucC genetically engineered bacteria in Example 2 above, the inventors further optimized the cultivation process. After repeated adjustments to various culture conditions, it was found that the adjustment of the pH in the initial medium and the fermentation medium is relatively important. Although the starting strain S.erythraea E3 had a strong adaptability to pH, the E3-△sucC genetically engineered strain was not like this. Its acid production performance was different from that of the starting strain, making it necessary to adjust pH.

[0070] The fermentation process uses inexpensive synthetic media. The medium prepared according to the formula of the synthetic medium was fixed to 2370ml, the pH was adjusted to 7.0 before sterilization, and then poured into a 5L fermenter, and 1.5ml of antifoaming agent was added, and the fermenter was wrapped up and kept at 121°C Autoclave for 6...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an optimized fermentation method of saccharopolyspora erythraea with an sucC gene knocked out. The inventor observes the phenomenon that the yield of erythrocin is influenced due to autolysis of engineering bacterium in the later period of the fermentation process, and further effectively reduces the autolysis of the saccharopolyspora erythraea with sucC gene knocked out byimproving the process of adjusting the pH value and adding ammonium sulfate in a specific time period; and besides, the proportion of erythromycin A of the genetically engineered bacterium in a totalerythromycin product is also greatly increased. Under the condition that a synthetic (type) culture medium is utilized, the yield and purity of the erythromycin A are high, and the method is suitablefor industrial application.

Description

technical field [0001] The invention belongs to the technical field of fermentation engineering, and more specifically, the invention relates to an optimized fermentation method of E3-ΔsucC genetically engineered bacteria. Background technique [0002] Saccharopolyspora erythraea is a Gram-positive filamentous actinomycete. The most important feature of this bacterium is that it can produce an antibiotic with significant medical efficacy: erythromycin. Erythromycin is an important broad-spectrum 14-membered ring macrolide antibiotic commonly used in the treatment of many diseases caused by Gram-positive pathogens. [0003] At present, in industrial production, erythromycin is mainly produced by means of fermentation. Similar to the production of antibiotics by secondary metabolic reactions in other actinomycetes, the synthetic process of erythromycin is complex and largely affected by the composition of the medium and culture conditions. In recent years, many researchers a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12P19/62C12R1/645
CPCC12N1/20C12N9/93C12P19/62C12Y602/01
Inventor 黄明志原玉洁徐峰陈冲冲储炬庄英萍
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap