Unlock instant, AI-driven research and patent intelligence for your innovation.

Antisense RNA sequence combination and method for inhibiting gonad development of pelteobagrus fulvidraco and application

An antisense technology for yellow catfish, which is applied in the fields of molecular biology and breeding biology, can solve the problems of high consumption, difficulty in growing seedlings to market specifications, prolonging the marketing cycle of yellow catfish, etc., achieving high success rate and shortening the marketing time Cyclic, representative and stable effects

Active Publication Date: 2021-03-26
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the yellow catfish needs to consume a lot of energy for reproduction in the breeding season. In high-density pond culture, it is difficult for the seedlings to grow to the market size (above 50g), which in turn prolongs the market cycle of the yellow catfish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antisense RNA sequence combination and method for inhibiting gonad development of pelteobagrus fulvidraco and application
  • Antisense RNA sequence combination and method for inhibiting gonad development of pelteobagrus fulvidraco and application
  • Antisense RNA sequence combination and method for inhibiting gonad development of pelteobagrus fulvidraco and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] An antisense RNA sequence combination for inhibiting the gonad development of pelagic catfish consists of Anti-FSHR-1 and Anti-FSHR-2, wherein the nucleotide sequence of Anti-FSHR-1 is:

[0051] 5'-AAAAACATGTCCCCTGCGTGCATCATGAGCCAAGAGAGTGTGAAGCGCAGCATAGCACCCAGACCATCTTCTTCATTTTTATGAAGAAATGCCCTCCTA-3' (SEQ ID No. 1).

[0052] The nucleotide sequence of Anti-FSHR-2 is:

[0053] 5'- AGATCATATGTAGACGACAATAGCTTATGGTGTATGAATTTGGAAAGTTTTTGGGGGTCAGTGGGGATGAGCAACATGTCCCAGTGAGTATAGCGTCCCA-3' (SEQ ID No. 2).

Embodiment 2

[0055] A method for inhibiting the development of the gonads of the peliotus catfish, the steps are as follows:

[0056] 1) After the two antisense RNA sequences in Example 1 were synthesized, they were cloned into the pcDNA3.1 expression vector between the XhoI and XbaI sites (containing the highly expressed CMV promoter), and this product was used as a subsequent PCR amplification template.

[0057] 2) PCR amplification: design a pair of specific primers for template amplification, the specific primers are PolyAF2 and PolyAR1; wherein, the nucleotide sequence of polyAF2 is 5'-TTTTGCGCTGCTTCGCGATGTAC-3' (SEQ ID No.3); The nucleotide sequence of the primer polyAR1 is 5'-TCCCAATCCTCCCCCTTGCTG-3' (SEQ ID No.4). The reaction system is 50 μL and consists of the following components: 25 μL of 2×Mastermix, 5 μL of primers, 18 μL of ultrapure water, and 2 μL of template. The amplification program was: pre-denaturation at 95°C for 2 min, 34 cycles (denaturation at 95°C for 30 s, ann...

Embodiment 3

[0065] Test plan: the newly hatched larvae of Example 2 were placed in a small-scale circulating water system and raised for 60 days, and then transferred to a large-scale circulating water system for breeding. The breeding cycle is 12 months. Each test group was fed extruded feed twice a day, and the feeding amount was 5% to 15% of body weight. The feed contains 40% protein and 8% fat.

[0066] PCR and agarose gel electrophoresis to verify transfection effect

[0067] After 200 days of breeding, randomly select 13 test fish of the antisense RNA fragment transfection group (test group), 7 test fish of the negative control group (negative control group) and 6 test fish of the control group (control group) to cut off the gonads respectively. Tissues were tested for transfection effect, and genomic DNA was extracted using TakaRa MiniBEST Universal Genomic DNAExtraction KitVer 5.0 kit. 20 μL reaction system, including: upstream and downstream primers (polyAF2: TTTTGCGCTGCTTCGCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an antisense RNA sequence combination and method for inhibiting gonad development of pelteobagrus fulvidraco and application, and belongs to the technical field of molecular biology and breeding biology. The antisense RNA sequence combination for inhibiting gonad development of the pelteobagrus fulvidraco provided by the invention comprises antisense RNA for inhibiting an FSH receptor. The antisense RNA sequence combination can inhibit mRNA transcription of the FSH receptor of the pelteobagrus fulvidraco, thereby interfering with the generation and development of oocytesand spermatogenic cells, inhibiting gonad development of the pelteobagrus fulvidraco, and greatly shortening the marketing period of the pelteobagrus fulvidraco; and the antisense RNA sequence combination provided by the invention can also realize effective and accurate regulation and control of expression of a target gene, has extremely small damage to ova, is high in success rate and stable inbred offspring phenotype, and has an extremely good application prospect.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and breeding biology, and in particular relates to an antisense RNA sequence combination, method and application for inhibiting the development of the gonad of yellow catfish. Background technique [0002] The yellow catfish belongs to the Siluriformes, the family Pelidae, and the yellow catfish genus. It is a species with high economic value in the yellow catfish genus. Pelter catfish is an important freshwater high-quality economic fish in my country because of its tender meat, delicious taste, rich nutrition, and no intermuscular spines. It is deeply loved by consumers. The market demand is increasing year by year, and the market is in short supply. [0003] However, yellow catfish needs to consume a lot of energy for reproduction during the breeding season. In high-density pond culture, it is difficult for the seedlings to grow to market size (above 50g), which prolongs the market c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85A01K67/027
CPCC12N15/1138C12N15/8509A01K67/0278A01K2217/058A01K2207/05A01K2207/15A01K2217/072A01K2227/40A01K2267/03
Inventor 强俊曹哲明陶易凡朱昊俊包景文徐跑
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI