Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for realizing fermentative expression of angiotensin converting enzyme 2 by using prokaryotic cell

A technology of prokaryotic organisms and extracellular regions, which is applied in the biological field to achieve the effects of large protein extraction, increased water solubility, and low price

Pending Publication Date: 2021-04-09
TSINGHUA UNIV +1
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The above applications all need to be able to economically and stably produce angiotensin-converting enzyme 2 (ACE2) for research use; but according to the applicant's knowledge, there is currently no expression of angiotensin-converting enzyme 2 using fermentation technology in the prior art (ACE2) method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for realizing fermentative expression of angiotensin converting enzyme 2 by using prokaryotic cell
  • Method for realizing fermentative expression of angiotensin converting enzyme 2 by using prokaryotic cell
  • Method for realizing fermentative expression of angiotensin converting enzyme 2 by using prokaryotic cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Embodiment 1 uses the design and result analysis of expressing ACE2 in Escherichia coli

[0069] The first step is to construct a recombinant expression vector with a HIS tag or a Strep-II tag.

[0070] Wherein, the ACE2 (18-805aa) target protein sequence is the sequence of SEQ ID NO.1;

[0071] The nucleotide sequence corresponding to the amino acid sequence of SEQ ID NO.1 is the sequence of SEQ ID NO.2;

[0072] ACE2 (18-740aa) target protein sequence is the sequence of SEQ ID NO.3;

[0073] The nucleotide sequence corresponding to the amino acid sequence of SEQ ID NO.3 is the sequence of SEQ ID NO.4;

[0074] ACE2 (18-615aa) target protein sequence is the sequence of SEQ ID NO.5;

[0075] The nucleotide sequence corresponding to the amino acid sequence of SEQ ID NO.5 is the sequence of SEQ ID NO.6;

[0076] The nucleotide sequence of the empty vector (derived from pET-30a(+)) used was set as SEQ ID NO.7.

[0077] It should be noted that the sequences inserted in...

Embodiment 2

[0129] Example 2 Production process and result analysis using Corynebacterium glutamicum to express ACE2

[0130] The first step is to construct a recombinant expression vector (with signal peptide)

[0131] In order to improve the expression effect, in particular a signal peptide sequence was also inserted before the ACE2 gene.

[0132] The plasmid constructed here is pXMJ19, and the involved signal peptide Sec signal peptide BZH001-cspB has the sequence SEQ ID NO.8:

[0133] ATGTTCAACAACCGTATCCGTACCGCCGCCCTCGCAGGTGCCATCGCAATCTCTACCGCAGCGTCTGGTCTGGTGGTCCCCAGCATTCGCTCAGGAA; alternatively, the TAT signal peptide CGR0949 is used, which has the sequence SEQ ID NO.9:

[0134] ATGCAAATAAACCGCCGAGGCTTCTTAAAAGCCACCGCAGGACTTGCCACTATCGGCGCTGCCAGCATGTTTATGCCAAAGGCCAACGCCCTTGGAGCA.

[0135] The second step is to select the expression host bacteria and introduce the vector

[0136] The selected strain was C. glutamicum CGMCC1.15647 (BZH001). Similar to Example 1, the engineering plasm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a plasmid containing angiotensin converting enzyme 2 (ACE2), a prokaryotic cell containing the plasmid and a method for realizing fermentative expression of ACE2 by using the prokaryotic cell as a host cell. The invention also relates to a method for producing ACE2 by using a prokaryote. The method comprises the following steps: constructing the plasmid containing a natural ACE2 sequence, knocking out the ACE2 sequence of a transmembrane region and an intracellular region, or further knocking out the ACE2 sequence of a part of extracellular region to serve as an exogenous gene; introducing the plasmid into a host prokaryote; culturing the host prokaryote, and expressing ACE2 in a culture; and extracting and purifying ACE2 from the culture.

Description

technical field [0001] The application belongs to the field of biotechnology, and in particular relates to a method for expressing angiotensin-converting enzyme 2 (ACE2) using prokaryotic cells as host cells. Background technique [0002] It is currently known that the specific cell receptor of the 2019 novel coronavirus SARS-CoV-2 is the ACE2 (Angiotensin-converting enzyme 2, angiotensin-converting enzyme 2) protein, so the development of novel coronavirus prevention and treatment protein drugs based on the ACE2 receptor protein And drug rapid screening platform, can be used as a new and effective strategy for the prevention and treatment of new coronaviruses. First of all, the receptor protein ACE2 can specifically bind to the new coronavirus, which is similar to the function of "antibody" to neutralize the virus and quickly excrete it from the body, so as to achieve the effect of the new coronavirus treatment. Second, the receptor protein ACE2 is relatively conservative ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/75C12N15/77C12N15/76C12N1/21C12N15/57C12R1/125C12R1/46C12R1/15C12R1/19
CPCC12N9/485C12Y304/17023C12N15/70C12N15/75C12N15/77C12N15/76
Inventor 邢新会卢元王怡苏楠李璐张翀
Owner TSINGHUA UNIV