Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Keshan disease genetic screening kit

A kit and technology for Keshan disease, applied in the directions of enzymes, biochemical equipment and methods, and microbial determination/examination, can solve the problem of failure to satisfactorily explain the pathogenesis of Keshan disease and its clinical characteristics, incomplete Identify the cause, etc.

Active Publication Date: 2022-03-18
SICHUAN PROVINCIAL PEOPLES HOSPITAL +2
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The etiological hypothesis of Keshan disease, one hypothesis is the nutritional biogeochemical etiological hypothesis, which mainly focuses on selenium deficiency as the main pathogenic factor causing the onset of Keshan disease, and the other is the biological etiology theory, mainly including Coxsackie virus, etc. The theory of viral infection, but none of them can satisfactorily explain the pathogenesis and clinical features of Keshan disease
In recent years, new progress has been made in the etiology research of dilated heart disease at home and abroad, and the role of genetic factors in the pathogenesis of dilated heart disease has been paid more and more attention. A few studies have suggested that the incidence of Keshan disease is related to related gene polymorphisms and mutations, but it has not been fully clarified. the cause of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Keshan disease genetic screening kit
  • Keshan disease genetic screening kit
  • Keshan disease genetic screening kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 Kit of the present invention (Sanger sequencing kit)

[0035] 1. Kit composition

[0036] The kit of the present invention includes amplification reagents and reagents for Sanger sequencing.

[0037] 1.1 Amplification Reagents

[0038] The PCR amplification reagent is used to amplify a DNA sequence where the SNP site is located, and its composition is shown in Table 1.

[0039] Table 1 PCR amplification reagents

[0040] components concentration volume PCR mix 2× 600μl Primer pair 10μM 100μl pure water 2ml

[0041] The PCR mixture in Table 1 includes components required for conventional PCR such as Taq enzyme, dNTP, and magnesium ions.

[0042] The sequencing amplification primer sequence of SEPHS2 c.868delG is as follows:

[0043] Forward primer: TGGCAGATTATGAATAACAAAGGACACT (SEQ ID NO.1), reverse primer: GCCCACCAATGGCTGGATA (SEQ ID NO.2);

[0044] Or, forward primer: TTTCCCTTTTCCACAATGCCAACG (SEQ ID NO. 3),...

experiment example 1

[0073] Experimental Example 1 Verification of Keshan Disease Mutation Gene

[0074] The inventor found a selenoprotein-related SEPHS2 gene mutation in the blood sample DNA of a Keshan disease patient. Compared with the NM_012248.2 transcript in Genbank, this mutation is a frameshift mutation c.868delG, the deletion of the 868th base G, resulting in a change in the base sequence of the DNA template chain, resulting in a loss of function (LOF) of the protein , the deletion of this base leads to the loss of translation of the subsequent amino acid at position 290 (glutamic acid). This mutation is a rare mutation with high pathogenicity.

[0075] Investigating the family of the patient with the SEPHS2 gene mutation (referred to as "patient A"), it was found that the brother of patient A did not suffer from Keshan disease, and the mother, sister and son of patient A all suffered from Keshan disease. The family diagram is as follows figure 1 shown.

[0076] The SEPHS2 gene of pati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Keshan disease selenoprotein-related gene screening kit, which belongs to the field of molecular diagnosis. The kit of the present invention can detect the SRPHS2 gene with c.868delG mutation, and then can screen Keshan disease; the present invention also provides a reagent for detecting the SRPHS2 gene with c.868delG mutation in the preparation of Keshan disease gene screening reagent Use in the box. The invention can make early warning for early diagnosis of Keshan disease and prenatal and postnatal care, and has good application prospect.

Description

technical field [0001] The invention belongs to the field of molecular diagnosis, in particular to a gene screening kit for Keshan disease. Background technique [0002] Keshan disease (KD) is an endemic cardiomyopathy, the pathogenic mechanism is not yet clear, the main myocardial lesion in Keshan disease patients is multiple focal necrosis. Since 1990, no cases of acute Keshan disease have been found in the national monitoring of Keshan disease. Only Sichuan Province found 6 cases of subacute Keshan disease in 2006. The survival rate of patients with chronic and latent Keshan disease is still relatively low. [0003] The etiology of Keshan disease is unknown. In addition to the high incidence of Keshan disease in epidemic areas, it is difficult to distinguish Keshan disease from heart expansion disease clinically. The clinical prognosis of Keshan disease is poor, which causes a burden to the family and society. Effective prevention and intervention measures become the key...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/52C12Q1/6883
CPCC12N9/00C12Q1/6883C12Q2600/156
Inventor 李小平罗蓉郑晨晴杨正林颜超马慧慧刘胜中刘明江
Owner SICHUAN PROVINCIAL PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com