Monoclonal antibody for resisting B cell maturation antigen and application of monoclonal antibody

A monoclonal antibody and B cell technology, applied in the field of biomedicine, can solve problems such as obvious side effects and insufficient clinical data

Active Publication Date: 2021-05-18
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Allogeneic hematopoietic stem cell transplantation can eliminate myeloma cells, but this therapy has significant side effects and only a small number of people benefit
In addition, monoclonal antibodies also show some potential in the treatment of myeloma, but there is not enough clinical data to confirm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monoclonal antibody for resisting B cell maturation antigen and application of monoclonal antibody
  • Monoclonal antibody for resisting B cell maturation antigen and application of monoclonal antibody
  • Monoclonal antibody for resisting B cell maturation antigen and application of monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060]This example is used for the construction of phage monoclonal antibody libraries and preliminary screening using ELISA. Specific steps are as follows:

[0061](1) Construction of phage monoclonal antibody library

[0062]After the expression of BCMA-Fc immunopoly peak camel, ELISA, ELISA, which express the extracellular zone, extract 200ml peripheral blood; select lymphocytes, obtain peripheral blood mononuclear lymphocytes precipitation, extract RNA;The III reverse transcription enzyme synthesis the first chain cDNA in RNA, and then expands the VHH gene using a nest type PCR; insert the VHH gene into the Pmecs phage display carrier, after electro-conversion of TG1, take a proper amount of bacterial liquid for library identification All the remaining cultures are evenly applied to the lb / ampglu plate. After the bacterium is long, collect the moss, add 1 / 3 volume of 50% glycerol, mix well, save, to obtain the storage capacity greater than 109Phage display camel VHH immune library.

[...

Embodiment 2

[0076]In this embodiment, the candidate clone was screened using Fluorescence Activated Cellsorting (FACS).

[0077]Cell culture was carried out according to standard cell culture regimen, and BCMA positive and negative cell suspensions were prepared using trimming. 300g centrifugal 5min removal culture solution, resuspended by Flow buffer to 2 × 106Cell / ml; add 2 × 10 to each of the 96-well plates in V-shaped bottom5A cell, 300 g of centrifugation for 5 min, removes the supernatant, and the VHH antibody was added to resuspend the cells, and incubated at 4 ° C for 1 h;

[0078]After 300g centrifugation 5min, remove the supernatant, Flow Buffer resuspended cells, using Flow buffer to dilute the APCANTI-His antibody to 2 μg / ml, 10 μl of resuspension cells per well, incubation for 1 h at 4 ° C; Flow buffer cleaning cells 3 times after 3 times, using 200 μl Flow buffer Resusted cells and transformed cytometry.

Embodiment 3

[0080]In this example, the VHH-MIGG2A Fc monoclonal antibody is expressed and purified, and the assay of antibody affinity is performed. In order to further identify the selected antibodies, the antibody is used to express the antibody by mammalian cells. Therefore, a plasmid vector with a mouse Fc tag expression vhh is constructed, which is recorded as C-4PCP.stuffer-MCG2A-Fc, and the specific steps are as follows:

[0081]1. Use PCR amplification BCMA VHH B46, which is:

[0082]HD-f (SEQ ID NO.10):

[0083]CGCGATTTTAAGGGTGTCCAGTGCGAGGTGCAGCTGTGTGGA;

[0084]HD-B46-R (SEQ ID NO.11):

[0085]Gcatggggacagggcttgattgtgggagagctcactgtcacctg

[0086]The reaction system is shown in Table 2, and the amplification procedure is shown in Table 3 below:

[0087]Table 2

[0088]

[0089]table 3

[0090]

[0091]2, the enzyme digestion is shown in Table 4, the enzyme digested temperature is 37 ° C, the time is 6 h, and the carrier after the exchanger is used.The PCR purification kit was purified, and the obtained DNA was dissolv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a monoclonal antibody for resisting a B cell maturation antigen and an application of the monoclonal antibody. A heavy chain variable region of the monoclonal antibody for resisting the B cell maturation antigen comprises a complementary determining region 1 as shown in SEQ ID NO. 1, a complementary determining region 2 as shown in SEQ ID NO. 2 and a complementary determining region 3 as shown in SEQ ID NO. 3. The antibody screened by using a phage display nano-antibody library has a specific CDR region, the obtained antibody can be specifically bound with a BCMA antigen, the affinity is good, the Ka(1 / Ms) is 3.03E+06, the Kd(1 / s) is 2.14E-04, and the KD(M) is 7.09E-11. Therefore, the monoclonal antibody has a wide application prospect in the aspect of immunotherapy of multiple myeloma.

Description

Technical field[0001]The present invention belongs to the field of biomedical technology, and more particularly to monoclonal antibodies of anti-B cell mature antigen.Background technique[0002]Multiple myeloma, mm) is a tumor caused by malignant proliferation of cym cells. It is a second common blood tumor, which has become a serious threat to the health of the elderly in an older population aged greater than 60 years old. A disease. The typical characteristic characteristics of multiple myeloma have a large amount of abnormal hyperplasia in the bone marrow, which secretes an abnormal immunoglobulin or immunoglobulin fragment, ie M protein.[0003]With the use of proteasome inhibitors such as boronzimomi and immunomodulatory drugs, the survival of multiple myeloma has been significantly improved. However, multiple myeloma is still unable to be completely cured. Multiple myeloma has high heterogeneity in biological and clinical, and therefore, it has a huge difference in different pati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804
Inventor石磊狄升蒙童东阳龚鹏飞马祖良
OwnerHUADAO SHANGHAI BIOPHARMA CO LTD