Chimeric antigen receptor, vector, human dendritic cell, cell line, solid tumor treatment medicine, preparation method and application

A chimeric antigen receptor, dendritic cell technology, applied in anti-tumor drugs, antibody medical components, antibody mimics/scaffolds, etc., can solve the problem of not yet obtained tumor-infiltrating DCs activity, and achieve the reversal of immunosuppressive effects. The effect of tumor microenvironment, optimization of preparation process, and enhancement of clearance capacity

Active Publication Date: 2021-05-25
SHENZHEN FRONTIERGATE BIOTECHNOLOGY CO LTD +1
View PDF9 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although multiple factors and signaling pathways have been elucidated to correct and reverse the abnormal behavior of DCs, great achievements have not been made in clinical application to effectively restore the activity of tumor-infiltrating DCs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor, vector, human dendritic cell, cell line, solid tumor treatment medicine, preparation method and application
  • Chimeric antigen receptor, vector, human dendritic cell, cell line, solid tumor treatment medicine, preparation method and application
  • Chimeric antigen receptor, vector, human dendritic cell, cell line, solid tumor treatment medicine, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] The present invention also provides a method for preparing human dendritic cells modified by the chimeric antigen receptor described in the above technical scheme, comprising the following steps: transducing the chimeric antigen receptor into the precursor cells of human dendritic cells, Induce differentiation to obtain chimeric antigen receptor-modified human dendritic cells. By adopting this method, the efficiency of expressing the CARDF structure on the surface of the dendritic cells is greatly improved, and the purity of the finally obtained CARDF-DCs reaches more than 85%. The chimeric antigen receptor in the present invention preferably infects precursor cells, and when the precursor cells are monocytes in human peripheral blood mononuclear cells, the virus multiplicity of infection in the process of infecting mononuclear cells in the present invention is preferably 100. In the present invention, the time for inducing differentiation of infected monocytes into DC ...

Embodiment 1

[0035] 1. Construction of lentiviral vector expressing CAR and the effect of different CAR structures on activating DCs derived from THP-1:

[0036] (1) Construction of lentiviral vector. The intracellular signaling domains of all DC-specific CARs were replaced by TLR4 (NM_138554.5), TNFR2 (NM_001066.3), Dectin1 (NM_197947) and FcRγ (NM_004106) by replacing 4-1BB and CD3ξ of the traditional second-generation T-CAR structure The intracellular domain part, all sequences were optimized and synthesized by the company (Guangzhou Aiji). The CAR was finally cloned into the lenti-Cas9 (Addgene) vector to replace Cas9. See the structure diagram figure 1 A in

[0037] The DF sequence is as follows:

[0038] nucleic acid sequence

[0039] CGCTGGCCTCCTTCTGCAGCTTGTTCGGGAAAAGAGTCAGTTGTT GCTATAAGGACCAATAGCCAATCTGACTTCCACTTACAAACTTATGGAG ATGAAGATTTGAATGAATTAGATCCTCATTATGAAATGCGACTGAAGATCCAAGTGCGAAAGGCAGCTATAACCAGCTATGAGAAATCAGATGGTGT TTACACGGGCCTGAGCACCAGGAACCAGGAGACTTACGAGACTCTGA AGCATG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Average volumeaaaaaaaaaa
Average volumeaaaaaaaaaa
Average volumeaaaaaaaaaa
Login to View More

Abstract

The invention relates to a chimeric antigen receptor, a lentiviral vector, a human dendritic cell, a cell line, an immunosuppressive solid tumor treatment drug, and a preparation method and application thereof, and belongs to the technical field of chimeric antigen receptors. The intracellular signal domain of the chimeric antigen receptor is selected from at least one of TLR4, TNFR2, Dectin-1 and Fc receptor gamma chain intracellular domain structures. In the presence of tumor targets, the chimeric antigen receptor disclosed by the invention can effectively activate human dendritic cells in vivo and in vitro, and can resist the environment formed by immunosuppressive molecules CTLA4-Ig and PD-L1, so that the ability of traditional CAR-T cells to remove immunosuppressive solid tumors is improved. According to the invention, in a clinically related humanized mouse tumor model, the human dendritic cell modified by the chimeric antigen receptor can effectively reverse an immunosuppressive tumor microenvironment and reactivate in-vivo depleted CAR-T cells, so that the progress of solid tumors is inhibited.

Description

technical field [0001] The invention relates to the technical field of chimeric antigen receptors, in particular to a chimeric antigen receptor, a lentiviral vector, human dendritic cells, a cell line, a drug for treating immunosuppressive solid tumors, a preparation method and an application thereof. Background technique [0002] Dendritic cells (DCs), as a bridge between the innate and adaptive immune systems, are the most effective antigen-presenting cells for activating humoral and cellular immunity, especially playing a key role in triggering tumor-specific immune responses , has immeasurable potential in tumor immunotherapy. In recent decades, a large number of DCs vaccines have been continuously developed, hoping to improve the effect of tumor immunotherapy. Most of the currently developed DCs vaccines are derived from monocytes induced by peripheral blood mononuclear cells (PBMCs) of patients, and they are loaded with specific DCs by pulsed peptides, proteins, tumor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2803C07K16/2866C07K14/7056C07K14/70535C12N15/86C12N5/0639C12N5/0696A61P35/00C12N2740/15043C12N2510/00C12N2800/107C07K2319/03C07K2319/00C12N5/0636A61K39/4622A61K39/464412A61K39/4611A61K2239/31A61K39/4631A61K39/464422A61K39/4615A61K2239/38A61K2039/86C07K2317/622C07K2319/33A61K2039/505C07K14/7051C07K14/70517C07K14/70578C07K14/705C07K2319/02C12N2740/16043C12N2501/515C12N2502/1114C12N2502/1121C12N2501/24A61K38/00A61K39/464429A61K2239/13A61K2239/21A61K2239/22A61K2239/17A61K35/17
Inventor徐洋
OwnerSHENZHEN FRONTIERGATE BIOTECHNOLOGY CO LTD