Primer-probe composition for detecting MYL3 gene mutation and application thereof
A primer-probe and composition technology, which is applied in the biological field, can solve the problems of high technical level requirements of inspectors, restricted product promotion and use, etc., and achieves the effects of good amplification efficiency, low cost, and short time-consuming.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0104] This embodiment provides a primer probe composition for detecting MYL3 gene mutation, which includes real-time fluorescent PCR primers and probes for detecting the new mutation site c.374A>C of MYL3 gene ;
[0105] The real-time fluorescent PCR primers include the nucleotide sequences shown in SEQ ID No.1-2.
[0106] SEQ ID No.1: 5'-TGCAGAGCTCAATACCAAGATG-3';
[0107] SEQ ID No. 2: 5'-CATTGCCCTCCTTGTCGAAGAC-3'.
[0108] The probes include wild-type MYL3 probes and mutant MYL3 probes;
[0109] The probe of the wild-type MYL3 includes the nucleotide sequence shown in SEQ ID No.3, and the probe of the mutant MYL3 includes the nucleotide sequence shown in SEQ ID No.4.
[0110] SEQ ID No. 3: TCCAAGAACAAGGACACAGGC;
[0111] SEQ ID No. 4: CCAAGAACACGGACACAGGCA.
[0112] The probe is a Taqman probe, the 5' end of the Taqman probe is marked with a fluorescent reporter group, and the 3' end is marked with a quenching group;
[0113] The fluorescent reporter group of the pro...
Embodiment 2
[0115] The present embodiment provides a kit for detecting MYL3 gene mutation, said kit including the primer probe composition for detecting MYL3 gene mutation in Example 1, PCR reaction solution, dyes and quality controls, said PCR reaction solution including DNA polymerase, Mg 2+ buffer, dNTPs and water, the dyes include Rox calibration dyes, and the quality controls include wild-type quality controls, homozygous mutant quality controls and heterozygous mutant quality controls.
[0116] In the present invention, the quality control product is prepared by the following method:
[0117] (1) Genome extraction: use a small genome extraction kit to extract the whole genome of the sample, measure the concentration and OD value after agarose electrophoresis detection, when OD 260 / 280 When it is between 1.8 and 2.0, it can be used as an amplification template;
[0118] (2) Using the extracted genome as a template, and setting a negative control group without adding templates, and ...
Embodiment 3
[0133] This example tests the performance of the kit for detecting MYL3 gene mutation constructed in Example 2, including construction of amplification curve, construction of standard curve, repeatability verification and specificity verification. The specific experimental steps and results are as follows.
[0134] Construct Amplification Curve
[0135] The wild-type quality control product and the homozygous mutant quality control product were respectively used as templates, and after the templates were serially diluted 10 times, the amplification curve was expanded using the kit for detecting MYL3 gene mutations constructed in Example 2.
[0136] The expanded system is as follows:
[0137]
[0138]
[0139] The amplification procedure is as follows:
[0140] Pre-denaturation: 95°C, 30s;
[0141] Cycle amplification: 95°C, 5s; 56°C, 34s; cycle 45 times;
[0142] Extension: 72°C, 2min.
[0143] The amplification curve of the wild-type quality control product is as fo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More