Supercharge Your Innovation With Domain-Expert AI Agents!

Nucleic acid composition, detection system, detection device and detection method for rapidly detecting Kubo fever virus

A nucleic acid composition and detection device technology, which can be applied to microorganism-based methods, biochemical cleaning devices, biochemical equipment and methods, etc., can solve problems such as unreported Kupo fever virus, and achieve lower detection costs and lower costs. , the effect of improving the detection efficiency

Active Publication Date: 2021-06-11
FUDAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, LAMP detection is mainly used in the detection of human and animal pathogens, food safety and environmental sanitation, and there are few reports on the detection of plant pathogens. There are no reports on the LAMP detection of Kupo fever virus at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid composition, detection system, detection device and detection method for rapidly detecting Kubo fever virus
  • Nucleic acid composition, detection system, detection device and detection method for rapidly detecting Kubo fever virus
  • Nucleic acid composition, detection system, detection device and detection method for rapidly detecting Kubo fever virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0052] The application will be described in further detail below in conjunction with the accompanying drawings and embodiments.

[0053] A nucleic acid composition for rapid detection of Kupo fever virus, comprising a primer set 1 for amplifying EKV-1 and a primer set 2 for amplifying EKV-2. Wherein, primer group one is according to the M gene (sequence shown in SEQ ID No.6 of EKV-1:

[0054]atgctggcacgaatcaagaagaaggcaagcggactccgctcatcctcgtcatccaaatcatccgatcctgaggatttcaaagtatcggcttacgcaccttcatgggacagggtagactatcacacagtttatgattttggtgaaaaagattatgaagaggctgtccctgaatataaaccaaattcagaaacattaacttgccatgtccaaagtaaccttgaaataataactagagtaccggtcagatcaataatggagatgctcagagttgcagaggcatttgttgatgagttccatgggacacttatgaccaaagtcataattacacctgtctatgagtctctggcaactcatttgacaaaggaccccacaacacgggattgcatcaatctacacaaatataaaagcgcacttgatgagatcattgttttcccagtttcaggagagatcaaggtcccttcagttgggatctcattctccacaaacatccagacaaccttcaaagggcacccttgcaccattaggttcaagctctctgcgaagccgacaaaaaggaacggacaatcaatatttgagatatacaatactcctttacct...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biological detection, and particularly discloses a nucleic acid composition, a detection system, a detection device and a detection method for rapidly detecting Kubo fever virus. The nucleic acid composition comprises a primer group I for amplifying EKV-1 and a primer group II for amplifying EKV-2, and an amplification product has high specificity. The detection system comprises a nucleic acid composition, a loop-mediated isothermal amplification reaction reagent and an indicator, a reaction result can be judged only by observing color change with naked eyes, and extra fluorescence reading equipment is not needed. The detection device comprises an upper fixing plate, a lower fixing plate and a plurality of paper-based controls, the paper-based controls are fixed between the upper fixing plate and the lower fixing plate, and the detection device has the advantage of real-time detection, is convenient and rapid to detect the library wave fever virus, is low in cost and is suitable for rapid screening. According to the method disclosed by the invention, reaction is performed under a constant-temperature condition, a reaction carrier is easy to obtain, a temperature circulating instrument with high value and tedious steps is not needed, and the detection cost is reduced.

Description

technical field [0001] The present application relates to the field of biological detection, more specifically, it relates to a nucleic acid composition, detection system, detection device and detection method for rapid detection of Kupo fever virus. Background technique [0002] Kupo fever virus is a tropical disease virus. It was first discovered in Nigeria, West Africa in 2015. It is a single-stranded negative-sense RNA virus with two subtypes, EKV-1 and EKV-2. The main vector of the virus is Culicoides. The symptoms are fever and the mortality rate is high. It is a very dangerous tropical disease virus. The main detection methods for this virus are colloidal gold method and PCR method. However, the detection time of the colloidal gold method is long, and the detection equipment of the PCR method is expensive and the operation is complicated, and there are many inconveniences in the detection. [0003] Loop-mediated isothermal amplification (Loop-mediated isothermal ampl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12M1/40C12M1/38C12M1/34C12M1/02C12M1/00C12R1/93
CPCC12Q1/70C12Q1/6844C12Q2600/16C12Q2537/143C12Q2531/119C12Q2563/173
Inventor 隋国栋张童卢惠君赵望张新联刘思秀
Owner FUDAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More