Nucleic acid composition, detection system, detection device and detection method for rapidly detecting Kubo fever virus
A nucleic acid composition and detection device technology, which can be applied to microorganism-based methods, biochemical cleaning devices, biochemical equipment and methods, etc., can solve problems such as unreported Kupo fever virus, and achieve lower detection costs and lower costs. , the effect of improving the detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0052] The application will be described in further detail below in conjunction with the accompanying drawings and embodiments.
[0053] A nucleic acid composition for rapid detection of Kupo fever virus, comprising a primer set 1 for amplifying EKV-1 and a primer set 2 for amplifying EKV-2. Wherein, primer group one is according to the M gene (sequence shown in SEQ ID No.6 of EKV-1:
[0054]atgctggcacgaatcaagaagaaggcaagcggactccgctcatcctcgtcatccaaatcatccgatcctgaggatttcaaagtatcggcttacgcaccttcatgggacagggtagactatcacacagtttatgattttggtgaaaaagattatgaagaggctgtccctgaatataaaccaaattcagaaacattaacttgccatgtccaaagtaaccttgaaataataactagagtaccggtcagatcaataatggagatgctcagagttgcagaggcatttgttgatgagttccatgggacacttatgaccaaagtcataattacacctgtctatgagtctctggcaactcatttgacaaaggaccccacaacacgggattgcatcaatctacacaaatataaaagcgcacttgatgagatcattgttttcccagtttcaggagagatcaaggtcccttcagttgggatctcattctccacaaacatccagacaaccttcaaagggcacccttgcaccattaggttcaagctctctgcgaagccgacaaaaaggaacggacaatcaatatttgagatatacaatactcctttacct...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com