Supercharge Your Innovation With Domain-Expert AI Agents!

Antibody for resisting B cell maturation antigen and application thereof

A B cell and chimeric antigen receptor technology, applied in the field of biomedicine, can solve the problems of obvious side effects and insufficient clinical data, and achieve the effect of improving the killing ability

Active Publication Date: 2021-06-18
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Allogeneic hematopoietic stem cell transplantation can eliminate myeloma cells, but this therapy has significant side effects and only a small number of people benefit
In addition, antibodies have also shown some potential in the treatment of myeloma, but there is not yet enough clinical data to confirm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody for resisting B cell maturation antigen and application thereof
  • Antibody for resisting B cell maturation antigen and application thereof
  • Antibody for resisting B cell maturation antigen and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This example is used for the construction and panning of the phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0063] (1) Construction of phage nanobody library

[0064] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after the titer was verified by ELISA, 200 mL of peripheral blood was drawn; lymphocytes were sorted, and peripheral blood mononuclear lymphocyte precipitates were obtained, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; inserts the VHH gene into the pMECS phage display vector, and after electrotransforming TG1 competent cells, take an appropriate amount of bacterial liquid for library identification , all the remaining cultures were evenly spread on LB / AMPGLU plates, and the lawn was collected after the bacteria grew out, and 1 / 3 of the volume of 50% glyce...

Embodiment 2

[0078] In this example, the candidate clones were screened using the flow cytometry fluorescence sorting technique (Fluorescence activated Cell Sorting, FACS).

[0079] Carry out cell culture according to the standard cell culture protocol, use trypsin to digest cells to prepare BCMA-positive and negative cell suspensions; 6 cell / mL; Add 2×10 to each well in a V-bottom 96-well plate 5 After centrifuging at 300g for 5min, remove the supernatant, add the crude extract of VHH antibody to resuspend the cells, and incubate at 4°C for 1h;

[0080] After centrifuging at 300g for 5 minutes, remove the supernatant, resuspend the cells in Flow Buffer, dilute the APCanti-his antibody to 2 μg / mL with Flow Buffer, resuspend the cells in 100 μL per well, and incubate at 4 °C for 1 hour; wash the cells with Flow Buffer 3 times, then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow cytometry.

Embodiment 3

[0082] In this example, the VHH-mIgG2a Fc antibody was expressed and purified, and the antibody affinity was measured. In order to further identify the screened antibodies, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was firstly constructed, which was denoted as C-4pCP.Stuffer-mCg2a-FC, and the specific steps were as follows:

[0083] 1. Using PCR to amplify BCMA VHH B21, the primers are:

[0084] HD-F (SEQ ID NO. 10):

[0085] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTGCAGCTGGTGGA;

[0086] HD-B8-R (SEQ ID NO. 11):

[0087] GCATGGAGGACAGGGCTTGATTGTGGGGCTACTCACTGTCACCTG

[0088] The reaction system is shown in Table 2, and the amplification program is shown in Table 3 below:

[0089] Table 2

[0090]

[0091] table 3

[0092]

[0093] 2. The enzyme digestion system is shown in Table 4. The enzyme digestion temperature is 37°C and the time is 6 hours. The PCR purification kit was used for purification...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an antibody for resisting a B cell maturation antigen and application of the antibody. The antibody is BCMA-21, and a heavy chain variable region of the antibody comprises a complementary determining region 1 as shown in SEQ ID NO. 1, a complementary determining region 2 as shown in SEQ ID NO. 2 and a complementary determining region 3 as shown in SEQ ID NO. 3. The antibody screened by utilizing a phage display nano antibody library has a specific CDR region, can specifically bind to a BCMA antigen with good affinity, and has Ka (1 / Ms) of 7.48E+06, Kd (1 / s) of 8.50E-04, and KD (M) of 1.14E-10. A chimeric antigen receptor and CAR-T cell can be constructed by using the antibody as the antigen-binding domain, and have obvious killing activity on BCMA-positive tumor cells.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to an anti-B cell mature antigen antibody and application thereof. Background technique [0002] Multiple myeloma (multiple myeloma, MM) is a malignant plasma cell disease, its tumor cells originate from plasma cells in the bone marrow, and plasma cells are cells that develop to the final functional stage of B lymphocytes. Therefore, multiple myeloma can be classified as B lymphocyte lymphoma. It is characterized by abnormal proliferation of bone marrow plasma cells with overproduction of monoclonal immunoglobulin or light chain (M protein), and very few patients can be non-secretory MM that does not produce M protein. Multiple myeloma is often accompanied by multiple osteolytic lesions, hypercalcemia, anemia, and kidney damage. Due to the suppression of normal immunoglobulin production, it is prone to various bacterial infections. [0003] At present, although the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804
Inventor 余学军狄升蒙石磊郑真真
Owner HUADAO SHANGHAI BIOPHARMA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More