Gene related to thousand seed weight of rape as well as molecular marker and application of gene
A technology of molecular markers and thousand-grain weight, which is applied in plant genetic engineering and biological fields, can solve the problems of low success rate, difficult crop breeding, cumbersome operation, etc., and achieve the effect of convenient identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: BnaGRF7.C02 Identification of genes
[0035] (1) Field test and phenotype determination of thousand-grain weight of rapeseed:
[0036] The field experiment was conducted from 2017 to the autumn of 2018. In late September, 42 varieties of rape germplasm with different thousand-grain weights were sown at Jiangsu University in Zhenjiang. They were harvested in May of the following year, dried naturally and then threshed. 1,000 seeds were randomly selected Weighed with an electronic balance, and repeated three times to get the average value. Among the 42 kinds of rapeseed, including Brassica napus inbred line K407 and Brassica napus double 11 No. ZS11 and other 40 different varieties of rapeseed (numbered 1~40), each The thousand-grain weights of rape varieties are shown in Table 1.
[0037] (2) Extract 42 kinds of Brassica napus germplasm genomic DNA:
[0038] Genomic DNA was extracted from 42 kinds of rapeseed germplasm leaves that had been sown for one mont...
Embodiment 2
[0051] Example 2: BnaGRF7.C02 Genes linked to thousand-kernel weight in canola
[0052] The thousand-grain weight of rapeseed is 1.4g-5.76g. According to the thousand-grain weight of 42 kinds of rapeseed harvested, it can be divided into three categories: small seeds (thousand-grain weight 2.31g-2.71g); large seeds (thousand-grain weight 5.21g-5.25g), super large seeds (thousand-grain weight>6g), as shown in Table 1. Compared with 42 kinds of rapeseed BnaGRF7.C02 The results of gene sequencing and its thousand-grain weight, among the 10 kinds of rapeseed germplasms with small seeds, 5 kinds of rapeseed germplasms BnaGRF7.C02 There are 15bp nucleotides in the gene, and the five kinds of rapeseed germplasm BnaGRF7.C02 Gene deletion of 15bp nucleotides; 10 kinds of large-seed rapeseed germplasm BnaGRF7.C02 All genes were missing 15bp nucleotides; and among the 20 kinds of rapeseed germplasms with super-large seeds, 4 kinds of rapeseed germplasms BnaGRF7.C02 There are 15bp nu...
Embodiment 3
[0060] Example 3: BnaGRF7.C02 The relationship between molecular marker primers and thousand-grain weight
[0061] Utilize Primer Premier 5.0 software, in sequence SEQ ID NO:5 BnaGRF7.C02 The upstream primer GRF715bp-F: GATGATCCTC ACGGGTATGGTCC (SEQ ID NO: 9) was designed at the 15bp of gene difference, and the downstream primer GRF715bp-1R was designed at a distance of 15bp of about 1000bp: TATGGATGTACTTCTTTCGTGGGAG (SEQ ID NO: 10), and the distance of 15bp was about 1000bp. A downstream primer GRF715bp-2R was designed at 1500bp: CCTGCTTGGCATAACTTTCTCT (SEQ ID NO: 11).
[0062] The upstream primer GRF715bp-F and the downstream primer GRF715bp-1R and downstream primer GRF715bp-2R respectively constitute two pairs of primers GRF715bp-1 and GRF715bp-2.
PUM
| Property | Measurement | Unit |
|---|---|---|
| Thousand kernel weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



