Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Gene related to thousand seed weight of rape as well as molecular marker and application of gene

A technology of molecular markers and thousand-grain weight, which is applied in plant genetic engineering and biological fields, can solve the problems of low success rate, difficult crop breeding, cumbersome operation, etc., and achieve the effect of convenient identification

Active Publication Date: 2021-07-02
JIANGSU UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, many genes have been identified to be involved in the regulation of thousand-grain weight, but the identification of these gene functions is mostly carried out through transgenics, which is cumbersome, long-term, and low in success rate, making it difficult to apply to crop breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene related to thousand seed weight of rape as well as molecular marker and application of gene
  • Gene related to thousand seed weight of rape as well as molecular marker and application of gene
  • Gene related to thousand seed weight of rape as well as molecular marker and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: BnaGRF7.C02 Identification of genes

[0035] (1) Field test and phenotype determination of thousand-grain weight of rapeseed:

[0036] The field experiment was conducted from 2017 to the autumn of 2018. In late September, 42 varieties of rape germplasm with different thousand-grain weights were sown at Jiangsu University in Zhenjiang. They were harvested in May of the following year, dried naturally and then threshed. 1,000 seeds were randomly selected Weighed with an electronic balance, and repeated three times to get the average value. Among the 42 kinds of rapeseed, including Brassica napus inbred line K407 and Brassica napus double 11 No. ZS11 and other 40 different varieties of rapeseed (numbered 1~40), each The thousand-grain weights of rape varieties are shown in Table 1.

[0037] (2) Extract 42 kinds of Brassica napus germplasm genomic DNA:

[0038] Genomic DNA was extracted from 42 kinds of rapeseed germplasm leaves that had been sown for one mont...

Embodiment 2

[0051] Example 2: BnaGRF7.C02 Genes linked to thousand-kernel weight in canola

[0052] The thousand-grain weight of rapeseed is 1.4g-5.76g. According to the thousand-grain weight of 42 kinds of rapeseed harvested, it can be divided into three categories: small seeds (thousand-grain weight 2.31g-2.71g); large seeds (thousand-grain weight 5.21g-5.25g), super large seeds (thousand-grain weight>6g), as shown in Table 1. Compared with 42 kinds of rapeseed BnaGRF7.C02 The results of gene sequencing and its thousand-grain weight, among the 10 kinds of rapeseed germplasms with small seeds, 5 kinds of rapeseed germplasms BnaGRF7.C02 There are 15bp nucleotides in the gene, and the five kinds of rapeseed germplasm BnaGRF7.C02 Gene deletion of 15bp nucleotides; 10 kinds of large-seed rapeseed germplasm BnaGRF7.C02 All genes were missing 15bp nucleotides; and among the 20 kinds of rapeseed germplasms with super-large seeds, 4 kinds of rapeseed germplasms BnaGRF7.C02 There are 15bp nu...

Embodiment 3

[0060] Example 3: BnaGRF7.C02 The relationship between molecular marker primers and thousand-grain weight

[0061] Utilize Primer Premier 5.0 software, in sequence SEQ ID NO:5 BnaGRF7.C02 The upstream primer GRF715bp-F: GATGATCCTC ACGGGTATGGTCC (SEQ ID NO: 9) was designed at the 15bp of gene difference, and the downstream primer GRF715bp-1R was designed at a distance of 15bp of about 1000bp: TATGGATGTACTTCTTTCGTGGGAG (SEQ ID NO: 10), and the distance of 15bp was about 1000bp. A downstream primer GRF715bp-2R was designed at 1500bp: CCTGCTTGGCATAACTTTCTCT (SEQ ID NO: 11).

[0062] The upstream primer GRF715bp-F and the downstream primer GRF715bp-1R and downstream primer GRF715bp-2R respectively constitute two pairs of primers GRF715bp-1 and GRF715bp-2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Thousand kernel weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a gene related to thousand seed weight of rape as well as a molecular marker and application of the gene, and belongs to the technical field of plant genetic engineering and biology. In the invention, firstly, the difference of 15bp of thousand seed weight related genes BnaGRF7. C02 in different rape germplasms of different thousand seed weights is analyzed through comparison, then the correlation of the 15bp difference and the thousand seed weight of the rape is obtained through correlation analysis, and a molecular marker primer related to the thousand seed weight of the rape is also designed for screening whether the BnaGRF7. C02 genes of the rape contain 15bp or not, and if the BnaGRF7. C02 genes of the rape contain 15bp, the BnaGRF7. C02 genes of the rape contain 15bp, the BnaGRF7. C02 genes of the rape do not contain 15bp. The method is used for rape high-yield breeding.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and biotechnology, and relates to a gene related to rapeseed thousand-grain weight, its molecular marker and application. Background technique [0002] Rapeseed is the largest oil crop in my country, accounting for 57.2% of the oil production of oil crops in my country, and is the main source of edible vegetable oil and biodiesel. Although the annual output of rapeseed in my country is relatively high, the sown area of ​​rapeseed continues to decline, and rapeseed is still in a stage of insufficient supply. my country's domestic vegetable oil dependence on foreign countries has exceeded 60%, and there is a tendency to continue to increase. Therefore, increasing rapeseed production is a must for rapeseed breeding. key goals. [0003] Molecular marker technology reflects the differences between individual organisms by detecting the variation of individual organisms in genes or genotypes. Wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C07K14/415C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 谭小力赵静曹维朱克明王政王朵朵金婵玉耿瑞
Owner JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com