Unlock instant, AI-driven research and patent intelligence for your innovation.

A gene related to rapeseed thousand-grain weight and its molecular marker and application

A technology of molecular markers and thousand-grain weight, which is applied in the field of plant genetic engineering and biology, can solve the problems of low success rate, long cycle, difficult crop breeding, etc., and achieve the effect of convenient identification

Active Publication Date: 2022-06-21
JIANGSU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, many genes have been identified to be involved in the regulation of thousand-grain weight, but the identification of these gene functions is mostly carried out through transgenics, which is cumbersome, long-term, and low in success rate, making it difficult to apply to crop breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene related to rapeseed thousand-grain weight and its molecular marker and application
  • A gene related to rapeseed thousand-grain weight and its molecular marker and application
  • A gene related to rapeseed thousand-grain weight and its molecular marker and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: BnaGRF7.C02 identification of genes

[0035] (1) Field test and phenotypic determination of 1000-grain weight of rapeseed:

[0036] The field experiment was carried out in the autumn of 2017 to 2018. In late September, 42 varieties of rapeseed with different 1000-grain weights were sown in Jiangsu University, Zhenjiang, and harvested in May of the following year. After natural drying, threshing was performed, and 1,000 seeds were randomly selected. Weighing with an electronic balance, repeating three times to get the average value, the 42 rapeseeds include the Brassica napus inbred line K407 and Brassica napus Shuang11 ZS11 and other 40 different rapeseeds (numbered 1-40), each The thousand-kernel weights of the varieties of rapeseed are shown in Table 1.

[0037] (2) Extraction of 42 kinds of Brassica napus germplasm genomic DNA:

[0038] Genomic DNA was extracted from 42 kinds of rape germplasm leaves that had been sown for 1 month, the quality of DNA wa...

Embodiment 2

[0051] Example 2: BnaGRF7.C02 Genes linked to 1000-kernel weight of rapeseed

[0052] The thousand-grain weight of rapeseed is 1.4g-5.76g. According to the thousand-grain weight of the harvested 42 kinds of rapeseed, it is divided into three categories: small seeds (thousand-grain weight 2.31g-2.71g); large seeds (thousand-grain weight 5.21g-5.25g), super large seeds (thousand kernel weight>6g), as shown in Table 1. Comparison of 42 kinds of rapeseed BnaGRF7.C02 Gene sequencing results and their thousand-kernel weights, among 10 rapeseed germplasms with small seeds, 5 kinds of rapeseed germplasms BnaGRF7.C02 There are 15bp nucleotides in the gene, and the 5 kinds of rapeseed germplasm BnaGRF7.C02 Gene deletion of 15bp nucleotides; 10 large seed rape germplasms BnaGRF7.C02 15bp nucleotides were deleted in all genes; and among the 20 kinds of rapeseed germplasms of super large seeds, 4 kinds of rapeseed germplasms had BnaGRF7.C02 There are 15bp nucleotides in the gene, 16 k...

Embodiment 3

[0060] Example 3: BnaGRF7.C02 The relationship between molecular marker primers and thousand-grain weight

[0061] Using Primer Premier 5.0 software, in sequence SEQ ID NO:5 BnaGRF7.C02 The upstream primer GRF715bp-F: GATGATCCTC ACGGGTATGGTCC (SEQ ID NO:9) was designed at the 15bp of the gene difference, and the downstream primer GRF715bp-1R was designed at a distance of about 1000bp from 15bp: TATGGATGTACTTCTTTCGTGGGAG (SEQ ID NO:10), a distance of about 15bp Downstream primer GRF715bp-2R was designed at 1500bp: CCTGCTTGGCATAACTTTCTCT (SEQ ID NO: 11).

[0062] The upstream primer GRF715bp-F and the downstream primer GRF715bp-1R and the downstream primer GRF715bp-2R respectively form two pairs of primers GRF715bp-1 and GRF715bp-2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene related to the thousand-grain weight of rapeseed and its molecular marker and application, which belong to the field of plant genetic engineering and biotechnology; in the present invention, firstly, the genes related to the thousand-grain weight of rapeseed with different thousand-grain weights are compared and analyzed BnaGRF7.C02 There is a 15bp difference in different rapeseed germplasms, and then through association analysis, it is found that the 15bp difference is associated with the thousand-grain weight of rapeseed, and the molecular marker primers related to the thousand-grain weight of rapeseed are also designed for screening rapeseed BnaGRF7.C02 Whether the gene contains 15bp and is used for high-yield breeding of rapeseed.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and biotechnology, and relates to a gene related to 1000-grain weight of rape, its molecular marker and application. Background technique [0002] Rape is the largest oil crop in my country, accounting for 57.2% of the oil production of oil crops in my country, and it is the main source of edible vegetable oil and biodiesel. Although the annual output of rapeseed in my country is relatively high, the sown area of ​​rapeseed continues to decline, and rapeseed is still in the stage of insufficient supply. The foreign dependence of domestic vegetable oil in my country has exceeded 60%, and there is a trend of continuous increase. Therefore, increasing the yield of rapeseed is a must for rapeseed breeding. key goals. [0003] Molecular marker technology is to reflect the differences between biological individuals by detecting the variation in genes or genotypes of biological individuals. With ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/11C07K14/415C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 谭小力赵静曹维朱克明王政王朵朵金婵玉耿瑞
Owner JIANGSU UNIV