A gene related to rapeseed thousand-grain weight and its molecular marker and application
A technology of molecular markers and thousand-grain weight, which is applied in the field of plant genetic engineering and biology, can solve the problems of low success rate, long cycle, difficult crop breeding, etc., and achieve the effect of convenient identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: BnaGRF7.C02 identification of genes
[0035] (1) Field test and phenotypic determination of 1000-grain weight of rapeseed:
[0036] The field experiment was carried out in the autumn of 2017 to 2018. In late September, 42 varieties of rapeseed with different 1000-grain weights were sown in Jiangsu University, Zhenjiang, and harvested in May of the following year. After natural drying, threshing was performed, and 1,000 seeds were randomly selected. Weighing with an electronic balance, repeating three times to get the average value, the 42 rapeseeds include the Brassica napus inbred line K407 and Brassica napus Shuang11 ZS11 and other 40 different rapeseeds (numbered 1-40), each The thousand-kernel weights of the varieties of rapeseed are shown in Table 1.
[0037] (2) Extraction of 42 kinds of Brassica napus germplasm genomic DNA:
[0038] Genomic DNA was extracted from 42 kinds of rape germplasm leaves that had been sown for 1 month, the quality of DNA wa...
Embodiment 2
[0051] Example 2: BnaGRF7.C02 Genes linked to 1000-kernel weight of rapeseed
[0052] The thousand-grain weight of rapeseed is 1.4g-5.76g. According to the thousand-grain weight of the harvested 42 kinds of rapeseed, it is divided into three categories: small seeds (thousand-grain weight 2.31g-2.71g); large seeds (thousand-grain weight 5.21g-5.25g), super large seeds (thousand kernel weight>6g), as shown in Table 1. Comparison of 42 kinds of rapeseed BnaGRF7.C02 Gene sequencing results and their thousand-kernel weights, among 10 rapeseed germplasms with small seeds, 5 kinds of rapeseed germplasms BnaGRF7.C02 There are 15bp nucleotides in the gene, and the 5 kinds of rapeseed germplasm BnaGRF7.C02 Gene deletion of 15bp nucleotides; 10 large seed rape germplasms BnaGRF7.C02 15bp nucleotides were deleted in all genes; and among the 20 kinds of rapeseed germplasms of super large seeds, 4 kinds of rapeseed germplasms had BnaGRF7.C02 There are 15bp nucleotides in the gene, 16 k...
Embodiment 3
[0060] Example 3: BnaGRF7.C02 The relationship between molecular marker primers and thousand-grain weight
[0061] Using Primer Premier 5.0 software, in sequence SEQ ID NO:5 BnaGRF7.C02 The upstream primer GRF715bp-F: GATGATCCTC ACGGGTATGGTCC (SEQ ID NO:9) was designed at the 15bp of the gene difference, and the downstream primer GRF715bp-1R was designed at a distance of about 1000bp from 15bp: TATGGATGTACTTCTTTCGTGGGAG (SEQ ID NO:10), a distance of about 15bp Downstream primer GRF715bp-2R was designed at 1500bp: CCTGCTTGGCATAACTTTCTCT (SEQ ID NO: 11).
[0062] The upstream primer GRF715bp-F and the downstream primer GRF715bp-1R and the downstream primer GRF715bp-2R respectively form two pairs of primers GRF715bp-1 and GRF715bp-2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


