Application of linc00084 in the preparation of adjuvant drugs for hypoxic tumor radiotherapy
A tumor radiotherapy and drug technology, applied in the field of biomedicine, can solve the problems of high cost and high cost of heavy ion accelerators, and achieve the effect of increasing tumor cure rate, accelerating extinction, and improving prognosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The expression of LINC00084 was up-regulated after heavy ion irradiation. Through biological sequencing and bioinformatics analysis, it was found that it can promote the expression of pro-apoptotic gene PDCD4 in tumor cells, thereby increasing the apoptosis of tumor cells. The nucleotide sequence of LINC00084 (ENST00000645023.1; chr11:65423125-65426499Homo sapiens) is as follows:
[0029]TGTGTGGAAGGAGGAAGGCAGGGAGAGGTAGAAGGGGTGGAGGAGTCAGGAGGAATAGGCCGCAGCAGCCCTGGAAATGATCAGGAAGGCAGGCAACCAAGGGCTGTGAACCCGCCTGGGGATGAGGCCTGGTCTTGTGGAACTGAACTTAGCTCGACGGGGCTGACCGCTCTGGCCCAGGGTGGTATGTAATTTTCGCTCGGCCTGGGACGGGGCCCAGGCCGGGCCCAGCCTGGTGGAGCGTCCAGGTCTGGGTGCGAAGCCAGGCCCCTGGGCGGAGGTGAGGGGTGGTCTGAGGAGTGATGTGGAGTTAAGGCGCCATCCTCACCGGTGACTGGTGCGGCACCTAGCATGTTTGACAGGCGGGGACTGCGAGGCACGCTGCTCGGGTGTTGGGGACAACATTGACCAACGCTTTATTTTCCAGGTGGCAGTGCTCCTTTTGGACTTTTCTCTAGGTTTGGCGCTAAACTCTTCTTGTGAGCTCACTCCACCCCTTCTTCCTCCCTTTAACTTATCCATTCACTTAAAACATTACCTGGTCATCTGGTAAGCCCGGGACAGTAAGCCGAGTGGCTGTTGGAGTCGGTATTGT...
Embodiment 2
[0030] Example 2 The Effect of Irradiation on the Expression of LINC00084
[0031] (1) Cell culture
[0032] The stable lung cancer cell line A549 cells were selected and cultured with RPMI-1640 complete medium at a constant temperature of 37°C and 5% CO 2 Cultured in a cell incubator; wash the cells with sterile PBS 2-3 times, and then digest with 0.25% trypsin for 1-2min. Resuspend RPMI-1640 complete medium; divide into new culture dishes, add RPMI-1640 complete medium for expanded culture, do not add hypoxic condition treatment during normal culture of cells, only perform hypoxic treatment before irradiation, and After irradiation, culture under hypoxic conditions was continued for subsequent experiments.
[0033] The hypoxic culture of cells adopts the ratio of 5% carbon dioxide, 94% nitrogen, and 1% oxygen for hypoxic culture, and the temperature is 37°C. Before the cells are irradiated, the cells with a suitable density are put into the hypoxic incubator. After 24 hou...
Embodiment 4
[0056] Example 4 Cell Proliferation Test
[0057] The A549 cells overexpressing LINC00084 were divided into 1×10 4 The density was planted in a 96-well plate, cultured in a hypoxic incubator (5% carbon dioxide, 94% nitrogen, 1% oxygen), and the cell proliferation level was measured every 24 hours. The cell proliferation test adopts the CCK-8 method. Before the test, the original old medium is discarded, and the complete medium containing 10% CCK-8 reagent is prepared, and the amount of 100 μL / well is added to the cells to be tested in the 96-well plate. Afterwards, incubate at 37°C in the dark for 2 hours. After the incubation, measure the absorbance at 450nm on a multi-functional microplate reader. The value of absorbance (OD value) is positively correlated with the level of cell proliferation. The larger the OD value, the more cell proliferation. see results Figure 5 , Figure 5 The results showed that overexpression of LINC00084 significantly inhibited the proliferation...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



