Check patentability & draft patents in minutes with Patsnap Eureka AI!

Chicken PTF1a gene recombinant protein and preparation method of polyclonal antibody

A polyclonal antibody and gene technology, applied in the fields of botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., can solve problems such as lack of PTF1a gene

Pending Publication Date: 2021-07-23
INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the defects and problems that there is no PTF1a gene-related research in the field of poultry research at present, the present invention provides a preparation and purification method of chicken PTF1a gene recombinant protein and polyclonal antibody

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken PTF1a gene recombinant protein and preparation method of polyclonal antibody
  • Chicken PTF1a gene recombinant protein and preparation method of polyclonal antibody
  • Chicken PTF1a gene recombinant protein and preparation method of polyclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: This example provides a method for preparing a chicken PTF1a gene polyclonal antibody, which includes gene synthesis, antigen purification, animal immunization, titer detection, antibody purification and verification, as follows.

[0027] 1. Synthesis of chicken PTF1a gene

[0028] 1. Amplification of the gene, enzyme digestion and connection with the vector

[0029] According to the Ptf1a gene CDS region sequence in Genbank, the primers for the specific amplification of the Ptf1a gene with efficient amplification ability are designed. , the base sequence is shown in Table 1.

[0030]

[0031] The Ptf1a gene sequence is:

[0032]ATGGAGACGGTGCTGCTGGAGCACTTCCCCGCGGGGCTGGACTCCTTCTCCTCGCCGCCCTACTTCGACGAGGAGGACTTCTTCCCCGAGCCGCCCCCGCGGGAGGCGCTGGGCGCCGACGGGCTGCCGGAGCCCGACGTGGACTTCCTCGGGCGGCAGCTGCACGAGTACTACCGCGACGGCGGGGACCCCGACGGCGGCTATTGCTGCGAGGCGGCGGCCGCCGCCTTCCCGCCGTCTCCCGCCTCGCCCGGCTTCGCCTACGAGTGCTGCGGGGCGGCGGGCGCGGGGCTGCTGTCGCCGGGGGGGCGGCTCCGGGCGCTGGGCTCGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of polyclonal antibody preparation, particularly relates to the technical field of molecular cloning and antibody preparation, and particularly relates to a chicken PTF1a gene recombinant protein and a preparation and purification method of a polyclonal antibody. A specific Ptf1a gene amplification primer with efficient amplification capability is designed according to the Ptf1a gene in Genbank, a recombinant antigen protein with correct size and purity of about 85% is prepared, Japanese big-ear rabbits are immunized to obtain high-titer antiserum, a specific polyclonal antibody with concentration of 10 mg / ml and purity of 90% is obtained through purification, the specific polyclonal antibody and the recombinant antigen have specific recognition at 47kDa through WB detection, and the specific polyclonal antibody has a single band, so that the specific polyclonal antibody can be used as an antibody for WB detection of chicken Ptf1a protein level, and provides reference for evaluation of chicken pancreas exocrine development conditions, chicken breeding and addition of functional enzyme preparations.

Description

technical field [0001] The invention belongs to the technical fields of molecular cloning and antibody preparation, and in particular relates to a method for preparing and purifying chicken PTF1a (Pancreasassociated transcription factor 1a) gene recombinant protein and polyclonal antibody. Background technique [0002] Acinar cells are derived from pancreatic stem cells expressing PTF1a, a bHLH transcription factor initially expressed in pancreatic progenitors and later present in acini. Lack of PTF1a leads to a blockage of acinar cell formation, and analysis of PTF1a mutant mice revealed a dosage threshold for PTF1a mRNA that allows pancreatic differentiation to result in development along a designated pathway. Reduction of PTF1a mRNA dose leads to reduced proliferation of early pancreatic progenitor cells and impaired exocrine cell differentiation. [0003] Studies in zebrafish have shown that reducing PTF1a expression leads to differentiation of multipotent progenitors t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/11C07K14/465C12N15/70C12N15/66C07K16/18C07K16/06
CPCC07K14/465C12N15/70C07K16/18C07K16/06C07K16/065
Inventor 袁林王明发李万利靳玮易宝弟王浩宇
Owner INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More