Unlock instant, AI-driven research and patent intelligence for your innovation.

System for evaluating ADE effect of novel coronavirus in vitro and construction method thereof

A technology of coronavirus and construction methods, applied in the direction of using vectors to introduce foreign genetic material, viruses/bacteriophages, biochemical equipment and methods, etc., which can solve problems such as molecular disputes

Active Publication Date: 2021-07-23
CHINA JAPAN FRIENDSHIP HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the cell lines for evaluating the ADE effect in vitro mainly include immune cell lines such as Raji, but the specific molecules involved are still controversial.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • System for evaluating ADE effect of novel coronavirus in vitro and construction method thereof
  • System for evaluating ADE effect of novel coronavirus in vitro and construction method thereof
  • System for evaluating ADE effect of novel coronavirus in vitro and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1, Construction of Fc receptor lentiviral expression vector

[0043] For the Wuhan-Hu-1 strain SARS-CoV-2 sequence, see

[0044] https: / / www.ncbi.nlm.nih.gov / nuccore / 1798174254.

[0045] The S gene of Wuhan-Hu-1 strain SARS-CoV-2 removed 19 amino acids at the end, and the sequence was codon-optimized, and then cloned into the BamHI / EcoRI site of pcDNA3.1(+) to obtain pcDNA-SARS2-S -614D.

[0046] 614 amino acid mutant pseudovirus SARS-CoV-2 (SARS-CoV-2USA-WA1 / 2020 strain, https: / / www.ncbi.nlm.nih.gov / nuccore / MT576563.1) S protein expression vector Construction: Synthesize the sequence containing the 614G mutant strain, construct it to the BamHI / EcoRI site of pcDNA3.1(+), and obtain pcDNA-SARS2-S-614G.

[0047] Fc receptor lentiviral expression vector construction:

[0048] Synthetic CD16A (https: / / www.ncbi.nlm.nih.gov / nuccore / NM_000569.8), CD32A (https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001136219.3), CD32B (https : / / www.ncbi.nlm.nih.gov / nuccore / NM_001002273....

Embodiment 2

[0049] Example 2, Construction of Immunoglobulin IgG Receptor FcγR Expression Cell Line

[0050] 293T, Huh7 cells were incubated at 37°C and 5% CO 2 cultivated under conditions. The medium was DMEM supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin. To construct a cell line expressing the Fc receptor gene, 1.5 μg pVSVG, 2 μg pLP1, 2 μg pLP2 and 5 μg pLenti-CD16A-Blast or pLenti-CD32A-Blast or pLenti-CD32B-Blast or pLenti-CD64A- Blast were co-transfected to 2.5×10 6 293T cells were replaced with fresh medium after 12 hours, and the supernatant of transfected cells was collected 48 hours after transfection, and passed through a 0.45 μm filter (millipore).

[0051] Mix the virus-containing supernatant and fresh medium at a ratio of 1:1, add 8 μg / ml polybrene, infect Huh7 cells, and screen with 10 μg / ml Blasticidin after 48 hours to obtain Huh7-CD16A, Huh7-CD32A, and Huh7-CD32B , Huh7-CD64A cells.

Embodiment 3

[0052] Example 3, Real-time RT PCR verification of the expression of immunoglobulin IgG receptor FcγR in cell lines

[0053] 5×10 5 Huh7 and its derivative cells Huh7-CD16A, Huh7-CD32A, Huh7-CD32B, and Huh7-CD64A cells were inoculated on a 6cm dish, lysed with Trizol, extracted total RNA, and performed real-time PCR after reverse transcription. The PCR primer sequences are as follows:

[0054] CD16A:forward:GACAGCGGCTCCTACTTCTG;

[0055] reverse:AGTCCTGTGTCCACTGCAAA;

[0056] CD32A: forward: TCCCACAAGCAAACCACAGT;

[0057] reverse: TGCTACAGCAGTCGCAATGA;

[0058] CD32B: forward:AGCGGATTTCAGCCAATCCC;

[0059] reverse:ATACGGTTCTGGTCATCAGGC;

[0060] CD64A: forward: AAGTCACAATGGCACCTACC;

[0061] reverse:GCTCAGGGTGACCAGATTCC;

[0062] GAPDH:forward:CTGCACCACCAACTGCTTAG;

[0063] reverse:GAGCTTCCCGTTCAGCTCAG.

[0064] In this example, in order to establish a more sensitive SARS-CoV-2 ADE detection cell line and identify FcγR molecules with ADE activity, Huh7 cells stably ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a system for evaluating the ADE effect of novel coronavirus in vitro and a construction method thereof. The system comprises expression cells of an immune globulin IgG receptor Fc [gamma] R, and / or a solution containing a novel coronavirus antibody, and / or a novel coronavirus pseudovirus. The immune globulin IgG receptor Fc [gamma] R is Fc [gamma] RIIA, i.e., CD32A. The novel coronavirus antibody promotes the novel coronavirus pseudovirus to infect the expression cells of the immune globulin IgG receptor Fc [gamma] RIIA (CD32A). The ADE effect of the novel coronavirus to be detected or the novel coronavirus antibody is evaluated according to the system. The ADE activity of the novel coronavirus antibody and antiserum is identified in vitro by using the SARS-CoV-2 pseudovirus and the cells for extrinsic expression of CD32A, and experiments prove that an ADE evaluation system based on the cells for extrinsic expression of CD32A is more sensitive and more reliable compared with an immune cell line and is a potential system for evaluating the ADE effect of the novel coronavirus.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a system for evaluating the ADE effect of a novel coronavirus in vitro and a construction method thereof. Background technique [0002] Antibody-dependent enhancement (ADE) was first discovered in the infection of dengue virus, that is, the subsequent infection of different serotypes of viruses will aggravate the disease process, and its mechanism is as follows: Antibodies with weak binding ability can mediate the enhanced infection of immune cells by viruses by binding to viral envelope proteins and Fc receptors on the surface of immune cells. Antibodies targeting dengue virus envelope proteins PrM and E may have ADE effects. In addition, ADE has been reported in HIV, influenza, and Ebola virus infections. [0003] In coronaviruses, it has long been found that feline infectious peritonitis virus infection or vaccination aggravates reinfection, proving that ADE may exist in coronav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/68C12N15/85
CPCG01N33/56983G01N33/6854C12N15/85G01N2333/165C12N2800/107Y02A50/30
Inventor 曹彬王在李海波邓婷婷张瑜廉聂强强杨晟楠刘培培
Owner CHINA JAPAN FRIENDSHIP HOSPITAL