Unlock instant, AI-driven research and patent intelligence for your innovation.

aldh2 gene polymorphism detection kit and detection method

A gene polymorphism and detection kit technology, applied in the field of biomedical gene detection, can solve the problems of long cycle, extremely high requirements on instrument parameters, and expensive instruments and equipment.

Active Publication Date: 2022-07-26
INST OF URBAN ENVIRONMENT CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage is that the modified technology has extremely high requirements on the parameters of the PCR instrument, the equipment is expensive, and usually the difference in Tm of a single base mutation is less than 0.5°C, especially for the identification of heterozygous mutations
[0008] 4. Sequencing method, as the gold standard for mutation screening, but it involves multiple steps such as PCR amplification, purification, and on-machine sequencing. The cycle is long and overlapping peaks are prone to occur during the sequencing process, which affects genotype discrimination
The disadvantage is that this technology needs to combine multiple steps such as PCR amplification, restriction enzyme digestion, desalting and purification, and mass spectrometry equipment is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • aldh2 gene polymorphism detection kit and detection method
  • aldh2 gene polymorphism detection kit and detection method
  • aldh2 gene polymorphism detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] An embodiment of the ALDH2 gene polymorphism detection primer set of the present invention includes the following primers and probes:

[0076] ALDH2 (rs671, c.1510G>A) polymorphic site detection primers: upstream non-restrictive primers with nucleotide sequence shown in SEQ ID No.1, nucleotide sequence shown in SEQ ID No.2 The downstream restriction primer and nucleotide sequence of the probe are shown in SEQ ID No.3.

[0077] Wherein, the 3' segment of the probe whose nucleotide sequence is shown in SEQ ID No. 3 is modified with C3 Spacer.

[0078] The designed PCR primers and probe sequences are shown in Table 1:

[0079] Table 1

[0080] name Sequence (5'-3') number of bases SEQ ID No.1 ALDH2-F GTTTGGAGCCCAGTCACCCTT 21 SEQ ID No.2 ALDH2-R AGCCACCAGCAGACCCTCAAGC 22 SEQ ID No.3 ALDH2-P CAGTTTTCACTTCAGTGTATGCCTGCAGCCCGC3Spacer 32

Embodiment 2

[0082] It relates to an embodiment of the ALDH2 gene polymorphism detection kit of the present invention, including the primers and probes of Embodiment 1, as well as 2×PCR Master Mix reaction premix and plasmid standard; wherein:

[0083] Plasmid standards include ALDH2*1*1(GG) plasmid standard (as shown in SEQ ID No.4), ALDH2*2*1 plasmid standard (as shown in SEQ ID No.5) and ALDH2*2*2 (AA) Plasmid standard (shown in SEQ ID No. 6).

[0084] The components contained in the 2×PCR Master Mix and their corresponding concentrations are: Tris-HCl 5mM-25mM, dNTPs 0.2mM-0.8mM, MgCl 2 1.0mM-6.0mM, KCl 10mM-50mM, Hot Start DNA Polymerase 0.05U / μL-0.2U / μL, Uracil DNA Glycosylase 0.01U / μL-0.1U / μL, SYTO-9 Dye 0.5μM-2.5 μM, pH 8.0-9.5.

[0085] The final working concentration of the corresponding primers is: 0.05μM-0.5μM for the upstream non-restrictive primer with the nucleotide sequence shown in SEQ ID No.1, 0.01μM for the downstream restriction primer with the nucleotide sequence sho...

Embodiment 3

[0093] Using the kit of Example 2 to detect the ALDH2 (rs671, c.1510G>A) gene polymorphism site in saliva samples, including the following steps:

[0094] 1. Saliva sample processing

[0095] The saliva was collected using a saliva harvester. The sample was briefly vortexed for 10s and then heated in a metal bath or water bath at 100°C for 10min to release the exfoliated cell DNA in the saliva and inactivate the PCR inhibitor. After cooling, it was briefly vortexed for 10s and centrifuged at 3000rpm for 5min. , take 3 μL of supernatant directly for PCR reaction template.

[0096] Biological samples can also be used for PCR after DNA extraction.

[0097] 2. PCR reaction system preparation and PCR amplification

[0098] The PCR reaction was prepared according to the reaction system shown in Table 2, and the PCR amplification program was according to the PCR amplification program shown in Table 3.

[0099] Table 2. PCR amplification reaction system

[0100] componen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an ALDH2 gene polymorphism detection kit and a detection method, the kit comprises an asymmetric primer for the ALDH2 gene polymorphism site and a probe closed at the 3' end; the asymmetric primer comprises a nucleotide sequence such as The upstream non-restrictive primer shown in SEQ ID No. 1 and the nucleotide sequence of the downstream restriction primer shown in SEQ ID No. 2; the nucleotide sequence of the probe blocked at the 3' end is shown in SEQ ID No. 3. The invention can increase the base melting temperature Tm difference of a single SNP site from 0.5 °C to 5 °C, reduce the requirements for the detection channel and high-resolution melting curve parameters of the PCR instrument, and do not need to rely on PCR instruments with multiple fluorescence detection channels. The single fluorescence detection channel instrument can directly detect and analyze the polymorphism site of the ALDH2 gene (rs671, c.1510G>A), which is suitable for popularization and use on the common experimental instrument platform.

Description

technical field [0001] The invention relates to the technical field of biomedical gene detection, in particular to an ALDH2 gene polymorphism detection kit and a detection method. Background technique [0002] Alcohol is mainly metabolized in the liver, and the acetaldehyde produced during the metabolism accumulates in the body, which can cause vasodilation and cause discomfort such as flushing, nausea, sweating, and elevated skin temperature. Studies have confirmed that acetaldehyde has cytotoxic and carcinogenic effects, and excessive accumulation of acetaldehyde in the body may increase the risk of alcoholic liver disease. As an important rate-limiting enzyme in acetaldehyde metabolism, acetaldehyde dehydrogenase ALDH2 can catalyze the formation of acetic acid from acetaldehyde, thereby achieving detoxification. [0003] The rs671SNP (rs671, c.1510G>A) site of the ALDH2 gene was mutated from guanoyin G to adrenalin A, resulting in a decrease in the catalytic activity ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12Q1/6858
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/107C12Q2521/531C12Q2563/173
Inventor 田美平黄清育
Owner INST OF URBAN ENVIRONMENT CHINESE ACAD OF SCI