Method for rapid quantification of high-throughput sequencing library of MGI platform and kit

A sequencing library, high-throughput technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of low specificity, non-specific amplification and inaccurate quantification

Active Publication Date: 2021-07-30
SHANGHAI REALBIO TECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, conventional QPCR methods use fluorescent dyes, which not only has low specificity, but also increases the risk of inaccurate quantification due to non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid quantification of high-throughput sequencing library of MGI platform and kit
  • Method for rapid quantification of high-throughput sequencing library of MGI platform and kit
  • Method for rapid quantification of high-throughput sequencing library of MGI platform and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1 has designed experimental group and control group, wherein experimental group selects SEQ ID NO:1 and SEQ ID NO:2 primer and SEQ ID NO:3 probe for use in experiment group; Control group selects control primer and control probe for use, used contrast The primer and control probe sequences are as follows:

[0057] The control primer includes an upstream primer and a downstream primer, wherein the upstream primer is the sequence shown in SEQ ID NO:9, the downstream primer is the sequence shown in SEQ ID NO:10, and the control probe is the sequence shown in SEQ ID NO:11.

[0058] SEQ ID NO:9CAACTCCTTGGCTCACAGAACG

[0059] SEQ ID NO:10TCCTAAGACCGCTTGGCCTC

[0060] SEQ ID NO:11CATGGCTACGATCCGAC

[0061] The above-mentioned primer probes and control primer probes were used to detect the positive standard. The specific PCR amplification system is shown in Table 1, and the amplification conditions are shown in Table 2. Among them, GoldStar Probe Mix is ​​a commer...

Embodiment 2

[0068] In order to determine the minimum detection limit of the primers and probes provided by the present invention, firstly, 5 μg of plasmid dry powder was diluted with 100 μL of nuclease-free water to 50 ng / μL as a storage solution, and then the storage solution was serially diluted for 10 1 ~10 8 times, and finally use the primer probe to test the gradient amplification situation to analyze the amplification efficiency and linearity of the primer probe of the present invention.

[0069] Wherein the PCR amplification system is shown in Table 1 of the above-mentioned Example 1, and the amplification conditions are shown in Table 2 of the above-mentioned Example 1. figure 2 Dilute 10 for primer-probe pair 1 ~10 7 The amplification curve results of the positive standard detection times.

[0070] Table 3 is the detection CT value of each concentration positive control substance for the provided primer probe

[0071] group Detection of CT value Dilution 10 ...

Embodiment 3

[0074] In the present invention, the Arabidopsis thaliana PHYA gene fragment is selected as an internal standard, and multiple fluorescent PCR technology is used to quantify the library and at the same time control the quality of the amplification reaction process. In this embodiment, the internal standard exists in the library diluent, and the working concentration is 0.1 pM. On the one hand, it can be used as the diluent of the library, and at the same time, it can also realize the function of the internal standard.

[0075] Example 1 selects 10 libraries qualified for quality inspection as amplification templates. The sample types include alveolar lavage fluid, sputum, blood, cerebrospinal fluid, tissues, etc., by means of fluorescent PCR (reaction system and conditions refer to the table in the embodiment) 1 and Table 2) for detection. The primer probe working solution also contains 10 μM internal standard upstream primer SEQ ID NO:4, 10 μM internal standard downstream pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for rapid quantification of a high-throughput sequencing library of an MGI platform and a kit. The method comprises the following step of carrying out fluorescent quantitative PCR detection on a to-be-detected high-throughput sequencing library by using a composition containing a primer and a probe; wherein the composition containing the primers and the probes comprises a first primer and a first probe which are used for detecting an MGI library, and a second primer and a second probe which are used for detecting an arabidopsis PHYA gene, the first primer comprises sequences shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the first probe comprises a sequence shown as SEQ ID NO: 3. The kit comprises the first primer and the first probe, and further comprises the second primer and the second probe, the second primer comprises sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the second probe comprises a sequence as shown in SEQ ID NO: 6. The provided method or kit can be used for rapid quantification of the high-throughput sequencing library.

Description

technical field [0001] The invention belongs to the field of gene sequencing, and in particular relates to a method and a kit for rapid quantification of a high-throughput sequencing library on an MGI platform. Background technique [0002] The purpose of high-throughput sequencing (NGS) library preparation is to connect specific adapter sequences to the fragmented nucleic acid fragments to be tested so that they can be sequenced on a high-throughput sequencing platform. The quality of NGS libraries is critical to the quality of data produced by high-throughput sequencing. Therefore, before the NGS library is sequenced on the machine, its concentration needs to be accurately determined, so that the appropriate sequencing concentration can be adjusted to obtain the optimal sequencing data when it is sequenced on the machine. [0003] Quantitative detection of samples can be achieved by performing fluorescent quantitative PCR (QPCR) detection on NGS libraries. It is to use s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12Q1/6876C12N15/11
CPCC12Q1/6851C12Q1/6876C12Q2600/166C12Q2600/16C12Q2531/113C12Q2545/113C12Q2563/107C12Q2537/143C12Q2561/101
Inventor杨超凡海峰秦楠
OwnerSHANGHAI REALBIO TECH CO LTD