Check patentability & draft patents in minutes with Patsnap Eureka AI!

Separated CYP450 protein as well as coding gene and application thereof

A protein and coding technology, applied in the field of medicinal plant genetic engineering, can solve problems such as difficulty in separation and purification

Active Publication Date: 2021-08-17
CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In eukaryotes, P450 enzymes are often combined with the inner mitochondrial membrane or endoplasmic reticulum membrane through the N-terminal hydrophobic sequence or hydrophobic ring, so it is difficult to separate and purify. monotony, resulting in very few CYP450 gene functions identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Separated CYP450 protein as well as coding gene and application thereof
  • Separated CYP450 protein as well as coding gene and application thereof
  • Separated CYP450 protein as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1, Cloning of Tripterygium wilfordii CYP81AM1 full-length cDNA sequence

[0038] 1. Extraction of total RNA from tripterygium wilfordii suspension cells and first-strand cDNA acquisition

[0039] Use the plant total RNA extraction kit to extract the total RNA of Tripterygium wilfordii suspension cells according to the instructions. Using the Fast QuantcDNA First Strand Synthesis Kit, the total RNA was reversed into cDNA according to the instructions.

[0040] 2. Primer Design

[0041] According to the transcriptome data annotation of Tripterygium wilfordii, the gene ORF sequence fragment was screened, and CYP81AM1-F and CYP81AM1-R primers were designed. The primer sequences are as follows:

[0042] CYP81AM1-F: ATGGAAACCCTTCACTACTTG (SEQ ID NO: 3)

[0043] CYP81AM1-R: TCATAGGTGGGAAAGTGCAGC (SEQ ID NO: 4)

[0044] 3.PCR amplification

[0045] DNA polymerase adopts high-fidelity DNA polymerase (Phusion High-Fidelity PCR Master Mix).

[0046] The cDNA obtained...

Embodiment 2

[0052] Embodiment 2, CYP81AM1 gene tissue expression analysis

[0053] 1. Handling of Experimental Materials

[0054] The roots, stems, leaves, and flowers of Tripterygium twig are collected from five different plants in the Yongan State-owned Forest Farm in Fujian. The samples were taken back to the laboratory for cleaning, quick-frozen in liquid nitrogen and stored in a minus 80 refrigerator.

[0055] 2. Extraction of total RNA and determination of gene expression by RNA-seq

[0056] The roots, stems, leaves, and flowers stored in the negative 80 refrigerator were crushed under liquid nitrogen environment, and the improved CTAB method was used (CTABBuffer: 2% CTAB (W / V); 100mmol L -1 Tris-HCl (pH 8.0); 25mmol L -1 EDTA; 2.0mol L - 1 NaCl; 0.5g L -1 Spermidine) was used to extract the RNA of different tissue parts of Tripterygium wilfordii, and the genome expression level was obtained according to the transcriptome sequencing. The RPMK value was used to represent the ge...

Embodiment 3

[0058] Example 3, Study on Biological Function of Tripterygium wilfordii TwCYP450

[0059] 1. Construction of eukaryotic expression vector

[0060] (1) Preparation of linearized empty vector: use the restriction endonuclease NotI of NEB Company to perform single enzyme digestion on the pESC-LEU:: TwCPR3 empty vector retained in the laboratory, and cut the gel to recover the digested product;

[0061] (2) Preparation of PCR product (target gene): Using the vector pEASY-Blunt-CYP81AM1 plasmid containing the full-length cDNA of Tripterygium wilfordii CYP81AM1 gene as a template, add a 15-25bp vector homology arm sequence (underlined part) to the 5' end of the primer , using PhusionDNA high-fidelity enzyme for PCR amplification of gene coding region. PCR program: 98°C 30s, 1 cycle; 98°C 10s, 60°C 10s, 72°C 2min 30s, 35 cycles; 72°C 5min; 4°C maintenance.

[0062] CYP81AM1-leuNotI-F: CCCTCACTAAAGGGCG ATGGAAACCCTTCAC (SEQ ID NO: 5)

[0063] CYP81AM1-leuNotI-R: CCATCGATACTAGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to tripterygium wilfordii cytochrome p450 oxidase CYP81AM1 and application of the enzyme in synthesis of abietane type diterpenoid compounds. The enzyme has the biological function of catalyzing dehydroabietic acid to be further oxidized to generate 15-hydroxyldehydroabietic acid. The invention also relates to a coding gene of the enzyme, a gene expression vector containing the coding gene and an engineering bacterium. According to the invention, the complete analysis of a triptolide biosynthetic pathway is promoted, and the enzyme has important significance on the synthesis regulation of diterpenoid compounds such as triptolide and the like.

Description

technical field [0001] The present invention relates to an isolated protein, tripterygium wilfordii cytochrome p450 oxidase CYP81AM1, and a polynucleotide encoding said enzyme, which can be used for diterpenoids (abietin-type diterpenoids, such as catalyzed 15 The biosynthesis of -hydroxydehydroabietic acid biosynthesis) belongs to the field of medicinal plant genetic engineering. Background technique [0002] Tripterygium wilfordii Hook.f. is a perennial vine of the genus Tripterygium wilfordii in the family Euonymus. It has good insecticidal activity and is widely used in anti-inflammatory, anti-tumor and immunosuppressive aspects. Terpenes are the main active ingredients of Triptolide, among which triptolide, an abietane-type diterpenoid, is recognized as one of the main active ingredients in Triptolide, and several triptolide derivatives have entered the clinical research stage. The development of new drugs from the active ingredients of traditional Chinese medicine is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12P33/00
CPCC12N9/0073C12N15/81C12P33/00
Inventor 高伟王家典苏平
Owner CAPITAL UNIVERSITY OF MEDICAL SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com