Separated CYP450 protein as well as coding gene and application thereof
A protein and coding technology, applied in the field of medicinal plant genetic engineering, can solve problems such as difficulty in separation and purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1, Cloning of Tripterygium wilfordii CYP81AM1 full-length cDNA sequence
[0038] 1. Extraction of total RNA from tripterygium wilfordii suspension cells and first-strand cDNA acquisition
[0039] Use the plant total RNA extraction kit to extract the total RNA of Tripterygium wilfordii suspension cells according to the instructions. Using the Fast QuantcDNA First Strand Synthesis Kit, the total RNA was reversed into cDNA according to the instructions.
[0040] 2. Primer Design
[0041] According to the transcriptome data annotation of Tripterygium wilfordii, the gene ORF sequence fragment was screened, and CYP81AM1-F and CYP81AM1-R primers were designed. The primer sequences are as follows:
[0042] CYP81AM1-F: ATGGAAACCCTTCACTACTTG (SEQ ID NO: 3)
[0043] CYP81AM1-R: TCATAGGTGGGAAAGTGCAGC (SEQ ID NO: 4)
[0044] 3.PCR amplification
[0045] DNA polymerase adopts high-fidelity DNA polymerase (Phusion High-Fidelity PCR Master Mix).
[0046] The cDNA obtained...
Embodiment 2
[0052] Embodiment 2, CYP81AM1 gene tissue expression analysis
[0053] 1. Handling of Experimental Materials
[0054] The roots, stems, leaves, and flowers of Tripterygium twig are collected from five different plants in the Yongan State-owned Forest Farm in Fujian. The samples were taken back to the laboratory for cleaning, quick-frozen in liquid nitrogen and stored in a minus 80 refrigerator.
[0055] 2. Extraction of total RNA and determination of gene expression by RNA-seq
[0056] The roots, stems, leaves, and flowers stored in the negative 80 refrigerator were crushed under liquid nitrogen environment, and the improved CTAB method was used (CTABBuffer: 2% CTAB (W / V); 100mmol L -1 Tris-HCl (pH 8.0); 25mmol L -1 EDTA; 2.0mol L - 1 NaCl; 0.5g L -1 Spermidine) was used to extract the RNA of different tissue parts of Tripterygium wilfordii, and the genome expression level was obtained according to the transcriptome sequencing. The RPMK value was used to represent the ge...
Embodiment 3
[0058] Example 3, Study on Biological Function of Tripterygium wilfordii TwCYP450
[0059] 1. Construction of eukaryotic expression vector
[0060] (1) Preparation of linearized empty vector: use the restriction endonuclease NotI of NEB Company to perform single enzyme digestion on the pESC-LEU:: TwCPR3 empty vector retained in the laboratory, and cut the gel to recover the digested product;
[0061] (2) Preparation of PCR product (target gene): Using the vector pEASY-Blunt-CYP81AM1 plasmid containing the full-length cDNA of Tripterygium wilfordii CYP81AM1 gene as a template, add a 15-25bp vector homology arm sequence (underlined part) to the 5' end of the primer , using PhusionDNA high-fidelity enzyme for PCR amplification of gene coding region. PCR program: 98°C 30s, 1 cycle; 98°C 10s, 60°C 10s, 72°C 2min 30s, 35 cycles; 72°C 5min; 4°C maintenance.
[0062] CYP81AM1-leuNotI-F: CCCTCACTAAAGGGCG ATGGAAACCCTTCAC (SEQ ID NO: 5)
[0063] CYP81AM1-leuNotI-R: CCATCGATACTAGTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


