DNAzyme capable of specifically recognizing toxoplasma gondii and having RNA cutting function and kit
A Toxoplasma gondii-specific technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, microbial determination/inspection, etc., to achieve strong stability, rapid detection and qualitative analysis, and easy artificial synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Synthesis of TG1-RFD: 5-GCAGTACGTAAGATATCGCTGGAAGTATGCGTTGTAGCTTAGTTCTTAACCGGATGCGCATTGTAGGCTCATTAAAGTTACGAGCTAGACGGCCGCATGGTTAGCTACACAGGTATAGAFRQGGTTCGATCAAGA-3 'sequence, where F is the fluorophore FAM-labeled dT, R adenine ribonucleotides, Q is DABCYL labeled dT. When the target molecule is present in the system, the FFD RNA target molecule binding enzyme activation function, thereby releasing the quencher, the fluorophore so that fluorescence signal recovery.
[0026]Anti-continent secreted protein ROP was added to the reaction solution containing 100 nm DNAzyme (100 mM hepes pH 7.5, 400 mM NaPES pH 7.5, 400 mM NaCl, 10 mM MgCl2, 0.02% Tween 20) was added to the same concentration of Dnazymes containing DNAZYME induced by Toxisocoprotein ROP. The screening buffer was controlled, and the mixture was incubated for 5 minutes;
[0027] If figure 2 Destrign, when an arckoid secreted protein ROP is added to the reaction mixture containing DNAzyme, the fluorescent signal is gr...
Embodiment 2
[0031] Synthesis of TG1-RFD: 5-GCAGTACGTAAGATATCGCTGGAAGTATGCGTTGTAGCTTAGTTCTTAACCGGATGCGCATTGTAGGCTCATTAAAGTTACGAGCTAGACGGCCGCATGGTTAGCTACACAGGTATAGAFRQGGTTCGATCAAGA-3 'sequence, where F is the fluorophore FITC-labeled dT, R is uracil ribonucleotides, Q is DABCYL labeled dT. When there is a target molecule in the system, the FFD is bonded to the target molecule to activate the RNA enzyme digestion, thereby releasing the quenching group to restore the fluorescent group fluorescent signal.
[0032] The method of detecting a rigid bow in a rigid probe is used, and the steps include:
[0033] (1) THP-1 and normal untraped THP-1 cells infected with Toxoplasma infection, a reaction solution containing 100 nm DNAzyme (screening buffer: 100 mM hepes pH 7.5, 400 mM NaCl, 10 mM mgCl2, 0.02%), respectively. TWEEN 20) Holled for 5 minutes;
[0034] (2) The reaction solution or the hand-held UV analyzer was measured by a fluorescence spectrophotometer, and the fluorescent signal was observed,...
Embodiment 3
[0036] (1) Synthesis of sequence shown in SEQ ID NO: 1, the todium infection of leukemia cells THP-1 and normal unopened THP-1 cells, respectively, a reaction liquid containing 100 nm DNAzyme (screening buffer: 100mm hepes) PH 7.5, 400 mM NaCl, 10 mM mgCl2, 0.02% Tween 20) mixed room temperature for 5 minutes;
[0037] (2) The above-mentioned reaction liquid is added to the colloidal gold test paper strip (TG101, Wenzhou Yousi Medical Technology Co., Ltd.) containing the DNAZYME identified by a rigid bow, and observes the color of the color, if it appears in T Then, the corresponding detection result is positive, such as Figure 5 Indicated. Combined with colloidal gold test paper readers, semi-quantitative analysis and data were uploaded.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



