Unlock instant, AI-driven research and patent intelligence for your innovation.

Reagent and method for qualitatively detecting BoHV1

A bovine herpes virus, type I technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of cumbersome operation process and expensive, and achieve simple operation, fast detection and saving The effect of instrument cost

Active Publication Date: 2021-08-20
SHENZHEN ANIEASY BIOTECHNOLOGY CO LTD
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The current method for BoHV1 nucleic acid detection is usually real-time fluorescent quantitative PCR method, which is the traditional method for detecting BoHV1, but this method requires expensive fluorescent quantitative PCR instrument, requires professionals to carry out cumbersome operations, and the time for on-board detection is at least more than 1 hour

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent and method for qualitatively detecting BoHV1
  • Reagent and method for qualitatively detecting BoHV1
  • Reagent and method for qualitatively detecting BoHV1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1: Primer Design

[0072] The inventors designed and screened a set of specific LAMP primers with the gC gene-specific site of BoHV1 as the target gene. The sequences of these primer sets are:

[0073] BoHV1-F3: CAGCTTGAGCTTCTCCACG (SEQ ID NO: 1);

[0074] BoHV1-B3: CTGGGCGTACATCTCGGA (SEQ ID NO: 2);

[0075] BoHV1-FIP: GCCAAAACCGCTTTCAGAAGCACATGTCCAGGGAAACCACG (SEQ ID NO: 3);

[0076] BoHV1-BIP: GCGTCGAAGACGCGGAAGACTCACGGCCGTCTACGA (SEQ ID NO: 4).

[0077] In addition, on the basis of the above sequence, the inventors also introduced a pair of loop primers to increase the amplification efficiency, the sequence of which is:

[0078] BoHV1-LF: GAGCAAGGTGAAGATTAACGG (SEQ ID NO: 5);

[0079] BoHV1-LB: TTAGCTTCCCGTAGCCGTC (SEQ ID NO: 6).

[0080] By using BLAST software for comparison, the inventors found that the sequences of the above six primers matched the corresponding sequences of the BoHV-1 virus in the database, and had no obvious crossover with other v...

Embodiment 2

[0081] Example 2: Detection of BoHV1

[0082] This embodiment provides exemplary specific steps for detecting BoHV1 on the sample to be tested.

[0083] First, the virus DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used to extract DNA.

[0084] Then, prepare the reagents. See Table 1 for the stock solution concentrations of the reagents used in the LAMP amplification reaction. In the case of N samples to be tested, refer to Table 1, and calculate the dosage of each component according to the number of N+3 (N samples to be tested+1 negative control+1 positive control, prepare one more reaction to ensure that the reaction solution Accurate dispensing volume), add each reaction reagent into a 1.5mL PCR centrifuge tube, vortex or cover the lid and mix upside down 10-20 times, centrifuge for 30 seconds, dispense 23μL into each PCR tube, and pour into Add 1 drop of sealing solution (approximately 20 μL) to each tube.

[0085] Table 1...

Embodiment 3

[0089] Embodiment 3: Optimization of LAMP reaction system

[0090] Usually, the temperature of the LAMP amplification reaction is kept at 60° C. to 67° C., and the reaction time is 40 to 60 minutes. The present inventors found that the preferred reaction temperature for LAMP detection using the primer set of the present invention is 63° C., and the preferred reaction time is 45 minutes.

[0091] On this basis, the inventors also found that, in addition to reaction temperature and reaction time, dNTP and Mg 2+ The concentration also plays an important role in the detection effect. In order to obtain the best detection effect, the present invention targets different dNTPs and Mg 2+ Concentrations were tested in a series, as shown in Table 2 below. In addition, 6 specific primers were used in this example.

[0092] Table 2 2: dNTPs and Mg in optimization tests 2+ concentration

[0093] experiment number MgSO 4

[0094] Test results such as figure 2 As shown,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides an LAMP (Loop-Mediated Isothermal Amplification) primer group for specifically detecting BoHV1, a kit which contains the primer group and is used for detecting BoHV1 through an LAMP amplification technology, and a method for detecting BoHV1 through the LAMP amplification technology by using the primer group or the kit. According to the invention, rapid detection can be completed in 40-60 minutes after sampling, the BoHV1 detection efficiency is greatly improved, and the detection result can be judged through visual inspection.

Description

technical field [0001] The invention relates to the field of bovine herpes virus detection, in particular to a primer set, a kit and a method for qualitative detection of bovine herpes virus type I nucleic acid. Background technique [0002] Bovine herpesvirus type 1 (BoHV1) can cause infectious bovine rhinotracheitis (IBR) in domestic cattle and bison. The "List of Types I, II, and III Animal Epidemic Diseases" issued by the Ministry of Agriculture of the People's Republic of China No. 1125 is listed as a type II animal epidemic, which means that it may cause major economic losses and requires strict control and eradication measures. prevent the spread of disease. Therefore, rapid and convenient detection of BoHV1 will effectively prevent the spread of BoHV1. [0003] The current method for BoHV1 nucleic acid detection is usually real-time fluorescent quantitative PCR method, which is a traditional method for detecting BoHV1, but this method requires expensive fluorescent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/705C12Q1/6844C12Q2531/119C12Q2537/1376C12Q2563/107
Inventor 周巧妮许嘉婉周晨刘金华郑志慧朱宏基
Owner SHENZHEN ANIEASY BIOTECHNOLOGY CO LTD