Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of saccharomyces rouxii gene in improving yield of HDMF produced by microorganisms

A technology of Saccharomyces ruckeri and microorganisms, applied in the field of microorganisms, can solve the problems of unsuitable factory production and high price, and achieve the effects of high safety, good fragrance and environmental friendliness

Active Publication Date: 2021-09-21
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF18 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many scholars have carried out research on the production of HDMF by adding FDP to Saccharomyces ruckeri, and found that FDP can be used as a precursor of HDMF, but using FDP as a precursor is expensive and not suitable for factory production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of saccharomyces rouxii gene in improving yield of HDMF produced by microorganisms
  • Application of saccharomyces rouxii gene in improving yield of HDMF produced by microorganisms
  • Application of saccharomyces rouxii gene in improving yield of HDMF produced by microorganisms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1.1 Construction of QOR gene overexpression recombinant plasmid, FBA gene and TPI gene overexpression recombinant plasmid

[0036] Using the Saccharomyces ruxii genome as a template, gene amplification primers are shown in Table 1, and KOD FX Neo high-fidelity enzyme was used to perform QOR gene ( figure 1 A), FBA gene ( figure 1 B) and the cloning of TPI gene ( figure 1C), the successfully cloned QOR gene, FBA gene and TPI gene target fragments were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and DNAMAN 7.0 was used to splice the sequencing results. The obtained sequence was aligned with the QOR (XM_002494472.1), FBA (XM_002499162.1) and TPI (XM_002498482.1) sequences in the NCBI genome of Luxie yeast.

[0037] The sequence of the QOR gene coding region is as follows:

[0038] ATGCTTAGATCGACAATATCCTCAGTGTTCAACAAGAGGGCAACAATGGCAACCACAACTATTCCAAAGACCCAAAAAGTTATTTTGATTAACGATACTGGTAGTTATGATGTGCTGAAATACCAGGATCATCCGGTGCCTAGTATTACTGACAATGAATTATTGGTTAAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a saccharomyces rouxii gene in improving the yield of HDMF produced by microorganisms, and relates to the field of microorganisms. The saccharomyces rouxii gene is a QOR gene or a combination of an FBA gene and a TPI gene; nucleotide sequences of coding regions of the QOR gene, the FBA gene and the TPI gene are as shown in SEQ ID NO: 1-3; according to the present invention, the engineering bacteria prepared by using the combination of the QOR gene or the FBA gene and the TPI gene can substantially improve the yield of the natural HDMF, and has characteristics of good fragrance and high safety compared with the HDMF produced by using the chemical synthesis method; according to the engineering bacterium, exogenous 1, 4-naphthoquinone and D-fructose are respectively added into a YPD culture medium, so that the yield of HDMF can be further increased, and the production cost is reduced; meanwhile, when the target product is produced, the requirement on the production environment is lower, the energy consumption is low, the pollution is small, the method is more environment-friendly, and the synthesis steps are simple.

Description

technical field [0001] The invention relates to the field of microbes, in particular to the application of the gene of ruxie saccharomyces in improving the yield of HDMF produced by microorganisms. Background technique [0002] 4-Hydroxy-2,5-dimethyl-3[2H]-furanone (4-Hydroxy-2,5-dimethyl-3(2H)-furanone, HDMF), the molecular formula is C 6 h 8 o 3 , the molecular weight is 128.13. HDMF is a spice compound that widely exists in natural products. It has a rich aroma similar to brown sugar and baked goods. When the concentration is low, it has a fresh strawberry and pineapple aroma, so it is also called strawberry ketone or pineapple ketone. As a spice and flavor enhancer, HDMF is widely used in food, beverage and daily chemical products because of its low threshold value, low risk and high effect. GB2760-2011, the American Flavor Manufacturers Association (FEMA No.3174) and the Council of Europe (COE No.536) all recognize HDMF as a food safety spice, and it is a high-quali...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C12N15/60C12N15/53C12N1/19C12N15/81C12P17/04C12R1/645
CPCC07K14/39C12N9/88C12N9/0067C12N15/815C12P17/04C12Y401/02013C12Y112/05001
Inventor 戴凌燕李志江张东杰刘微潘百玲邓景致
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY