Construction method of vector for simultaneously expressing two foreign proteins by using tobacco rattle virus
A technology of exogenous protein and construction method, which is applied in the direction of introducing foreign genetic material using vectors, biochemical equipment and methods, recombinant DNA technology, etc. It can solve the problems of inability to express foreign protein, mutation or loss, and low expression level of target expression, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1, the construction of TRV expression vector
[0054] pTRV2e 1 Experimental material, pTRV2e 1 It is prepared using the plasmid pYL156 as a template, and its preparation method is clearly informed in the patent 201810261990.2.
[0055] The 2c gene promoter sequence of TRV is:
[0056]tagaatcggtccaatcgtttacggttggttattgtgattggttgatgaggaaattctgtttgaaggctggttgaaagtaccagggcgggagaagccatattctctatcgttgtaggaagcgattgaaataattcctgtggtcacgtcgcacgtgaggtggttgttaccataaacaataatgtcgttggcagcatttaaaataattccatagttactaagagggtgattgtgaccaaaggagcg,通过人工合成并克隆于载体pUC57中,得到pUC57-2c。 Using the vector pUC57-2c as a template, the promoter sequence of 2c was obtained by amplifying P3 / P4 with primers. The target fragment was recovered by tapping gel, cleaned and recovered by MluⅠ / SmaⅠ double enzyme digestion, and cloned into pTRV2e 1 , to obtain clone pTRV2e 3 . Primers P3 and P4 were CGacgcgtTAGAATCGGTCCAATCGTTTACG (acgcgt was MluI) and tccCCCGGGccatggGGTACCATggatccCGCTCCTTTGGTCACAATCACC...
Embodiment 2
[0059] Example 2, pTRV2e expressing foreign protein 3 Related vector construction
[0060] The size of the gfp gene is 720bp, and the sequence is:
[0061] atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggagaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacaccctcgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggccgacaagcaaaagaacggcatcaaagccaacttcaagacccgccacaacatcgaagacggcggcgtgcaactcgctgatcattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaatag。
[0062] The gfp gene was obtained by PCR amplification with primers P5 / P6, recovered from rubber tapping, cleaned a...
Embodiment 3
[0068]Example 3, Agrobacterium transformation, activation and expansion of TRV2-related vectors (refer to 201810261990.2)
[0069] Take 100uL of Agrobacterium GV3101 competent cells and put them into 1.5mL sterilized centrifuge tubes pre-cooled on ice, and add 100ng of plasmid pTRV2e respectively 1 , pTRV2e 3 , pTRV2e 3 -gfp-MCS2, pTRV2e 3 -MCS1-GFP and pTRV2e 3 -rfp-gfp, and gently blow and mix, place on ice for 30min; place in liquid nitrogen for 1min in a water bath at 42°C for 1min, then place on ice for 2min; add 500uL LB liquid medium without antibiotics, and incubate Shake culture in a shaker for 3-4 hours; respectively take 100uL of the above five bacterial culture solutions and spread evenly on LB solid plates containing (30mg / L Rifampicin, 50mg / L Gentamycin and 50mg / L Kanamycin), and place in a 28°C incubator Cultivate for 12-16 hours. Pick the above pTRV2e respectively 1 , pTRV2e 3 、TRVe 3 - gfp-MCS2 and pTRV2e 3 -MCS1-GFP and pTRV2e 3 -rfp-gfp single colo...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com