Supercharge Your Innovation With Domain-Expert AI Agents!

Construction method of vector for simultaneously expressing two foreign proteins by using tobacco rattle virus

A technology of exogenous protein and construction method, which is applied in the direction of introducing foreign genetic material using vectors, biochemical equipment and methods, recombinant DNA technology, etc. It can solve the problems of inability to express foreign protein, mutation or loss, and low expression level of target expression, etc. question

Active Publication Date: 2021-11-05
ZHEJIANG SCI-TECH UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The shortcomings of the program are: vector pTRV2e 2 TRV genomic RNA2 contains two cp gene promoters, and the virus exogenous protein expression vector constructed by the double cp gene subgenomic promoter strategy, the cp gene promoter introduced from outside sources will affect the integrity of the viral genome structure, and it is easy to Recombination, mutation or loss occurs in the host plant, so that the target expression of the virus foreign protein expression vector is low or unable to express the foreign protein at the late stage of infection or during the process of virus juice friction transfer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of vector for simultaneously expressing two foreign proteins by using tobacco rattle virus
  • Construction method of vector for simultaneously expressing two foreign proteins by using tobacco rattle virus
  • Construction method of vector for simultaneously expressing two foreign proteins by using tobacco rattle virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, the construction of TRV expression vector

[0054] pTRV2e 1 Experimental material, pTRV2e 1 It is prepared using the plasmid pYL156 as a template, and its preparation method is clearly informed in the patent 201810261990.2.

[0055] The 2c gene promoter sequence of TRV is:

[0056]tagaatcggtccaatcgtttacggttggttattgtgattggttgatgaggaaattctgtttgaaggctggttgaaagtaccagggcgggagaagccatattctctatcgttgtaggaagcgattgaaataattcctgtggtcacgtcgcacgtgaggtggttgttaccataaacaataatgtcgttggcagcatttaaaataattccatagttactaagagggtgattgtgaccaaaggagcg,通过人工合成并克隆于载体pUC57中,得到pUC57-2c。 Using the vector pUC57-2c as a template, the promoter sequence of 2c was obtained by amplifying P3 / P4 with primers. The target fragment was recovered by tapping gel, cleaned and recovered by MluⅠ / SmaⅠ double enzyme digestion, and cloned into pTRV2e 1 , to obtain clone pTRV2e 3 . Primers P3 and P4 were CGacgcgtTAGAATCGGTCCAATCGTTTACG (acgcgt was MluI) and tccCCCGGGccatggGGTACCATggatccCGCTCCTTTGGTCACAATCACC...

Embodiment 2

[0059] Example 2, pTRV2e expressing foreign protein 3 Related vector construction

[0060] The size of the gfp gene is 720bp, and the sequence is:

[0061] atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggagaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacaccctcgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggccgacaagcaaaagaacggcatcaaagccaacttcaagacccgccacaacatcgaagacggcggcgtgcaactcgctgatcattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaatag。

[0062] The gfp gene was obtained by PCR amplification with primers P5 / P6, recovered from rubber tapping, cleaned a...

Embodiment 3

[0068]Example 3, Agrobacterium transformation, activation and expansion of TRV2-related vectors (refer to 201810261990.2)

[0069] Take 100uL of Agrobacterium GV3101 competent cells and put them into 1.5mL sterilized centrifuge tubes pre-cooled on ice, and add 100ng of plasmid pTRV2e respectively 1 , pTRV2e 3 , pTRV2e 3 -gfp-MCS2, pTRV2e 3 -MCS1-GFP and pTRV2e 3 -rfp-gfp, and gently blow and mix, place on ice for 30min; place in liquid nitrogen for 1min in a water bath at 42°C for 1min, then place on ice for 2min; add 500uL LB liquid medium without antibiotics, and incubate Shake culture in a shaker for 3-4 hours; respectively take 100uL of the above five bacterial culture solutions and spread evenly on LB solid plates containing (30mg / L Rifampicin, 50mg / L Gentamycin and 50mg / L Kanamycin), and place in a 28°C incubator Cultivate for 12-16 hours. Pick the above pTRV2e respectively 1 , pTRV2e 3 、TRVe 3 - gfp-MCS2 and pTRV2e 3 -MCS1-GFP and pTRV2e 3 -rfp-gfp single colo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a vector pTRV2e3 for simultaneously expressing two foreign proteins in a non-fusion manner. The construction method comprises the following step: by taking an agrobacterium infectious clone pYL156 of TRV genome RNA2 as a material, constructing a promoter vector pTRV2e3 containing 2b and 2c genes of TRV by adopting a virus gene deletion strategy. The invention further provides a method for preparing the virus TRVe3-rfp-gfp capable of simultaneously expressing green fluorescent protein (GFP) and restriction fragment protein (RFP) by utilizing the pTRV2e3, and the virus TRVe3 can continuously and stably express two non-fused target proteins in a host plant at high content.

Description

technical field [0001] The invention relates to the field of molecular biology, and specifically includes a method for constructing a plant virus expression vector for expressing two non-fusion foreign proteins simultaneously and rapidly in a whole plant at a high content. Background technique [0002] With the completion of a large number of plant genome sequencing, a good carrier or technology is urgently needed to quickly analyze the biological functions of new genes or predicted proteins in the genome. At present, the most important way to study genes or proteins with unknown functions is to express the target protein in plants through transgenic technology to confirm its function, but the transgenic operation is cumbersome, the cycle is long, and species restrictions are restrictive factors. Currently, plant virus expression vectors are used to explore the biological properties of proteins. Learning function is also increasingly becoming a trend. [0003] High virus re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/65C12N15/66
CPCC12N15/8203C12N15/65C12N15/66
Inventor 廖乾生郭歌常发光赖家良杜志游
Owner ZHEJIANG SCI-TECH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More