DNA vaccine capable of simultaneously expressing FAdV-4 spike protein 1 and spike protein 2 genes as well as construction method and application of DNA vaccine

A DNA vaccine, spike protein technology, applied in the field of biomedicine, can solve the problems of no vaccine, economic loss, etc., and achieve the effect of improving the effect of immune prevention

Pending Publication Date: 2021-11-09
JIANGSU ACAD OF AGRI SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2014, the pericardial effusion-inclusion body hepatitis syndrome caused by FAdV-4 broke out in chicken flocks in my country, and spread rapidly across the country, causing huge economic losses to the chicken industry in my country, but there is still no vaccine available
However, at present, there is no research on the simultaneous use of spike protein 1 and spike protein 2 of FAdV-4 in the development of DNA vaccines.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA vaccine capable of simultaneously expressing FAdV-4 spike protein 1 and spike protein 2 genes as well as construction method and application of DNA vaccine
  • DNA vaccine capable of simultaneously expressing FAdV-4 spike protein 1 and spike protein 2 genes as well as construction method and application of DNA vaccine
  • DNA vaccine capable of simultaneously expressing FAdV-4 spike protein 1 and spike protein 2 genes as well as construction method and application of DNA vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] A method for constructing a DNA vaccine that simultaneously expresses FAdV-4 spike protein 1 and spike protein 2 genes, comprising the steps of:

[0031] 1. Design the specific primers P1 and P2 of FAdV-4 spike protein 1 and the specific primers P3 and P4 of spike protein 2, whose sequences are as follows:

[0032] P1: 5'AATTAAGCTTATGTCGGCCCTAATCGCCTCCGCAGCCG 3' (shown in SEQ ID No.2);

[0033] P2: 5'CCCGCCTGCTTAAGCAGGCTAAAGTTGGTCGCGCCGCTGCCGGGGCCCGGAGCATT3' (shown in SEQ ID No.3);

[0034] P3: 5'GCTTAAGCAGGCGGGCGATGTGGAAGAAAACCCGGGCCCGATGCTCCGGGCCCCT 3' (as shown in SEQID No.4);

[0035] P4: 5'TAAAGCGGCCGCTTACGGGAGGGAGGCCGCTGGACAGCTG 3' (shown in SEQ ID No. 5).

[0036] 2. PCR amplification of FAdV-4 spike protein 1 (fiber1) gene

[0037] (1) extract the DNA of FAdV-4 as template DNA, carry out the PCR amplification of fiber1 gene with specific primer P1 and P2;

[0038] (2) PCR amplification system: specific primer P1 1 μL, primer P2 1 μL, reaction solution contai...

Embodiment 2

[0056] Example 2: Expression identification of recombinant plasmid pC-fibers2A

[0057] The recombinant plasmid pC-fibers2A constructed in Example 1 was transfected and grown into DF1 cells, and the expression of spike protein 1 and spike protein 2 were detected by immunofluorescence 48 hours after transfection, and the specific steps were as follows:

[0058] (1) Dissolve 600ng of the recombinant plasmid pC-fibers2A in 50μL DMEM, mix well and let stand at room temperature for 5min; at the same time, dissolve 2μL transfection reagent lipofectamine 2000 in 50μL DMEM, mix well and let stand at room temperature for 5min; The plasmid pC-fibers2A was mixed with the DMEM solution of transfection reagent lipofectamine 2000 to make the transfection solution. After standing at room temperature for 20 minutes, it was dropped into DF1 cells. After 8 hours of cultivation, it was replaced with DMEM containing serum. After 48 hours of continuous cultivation, it was used for immunofluorescenc...

Embodiment 3

[0060] Embodiment 3: DNA vaccine immunization test

[0061] (1) The recombinant plasmid pC-fibers2A was inoculated into 10 21-day-old SPF chickens, each inoculation amount was 200 μg, and the leg muscles were injected at 2 points, and booster immunization was carried out 14 days after the inoculation. The inoculation dose and method were the same as those of the first The second immunization was the same as the immunization group; at the same time, pCDNA3.1 empty vector injection was set as the control group, a total of 10 chickens;

[0062] (2) Challenge the virus 21 days after the booster immunization (the HN15 strain is FAdV-4, which is derived from the diseased chicken infected with FAdV-4), the challenge dose of each chicken is 100CLD50 (chicken half-lethal dose), and the virus challenge mode is Intramuscular injection, observe and record the morbidity and mortality of chickens;

[0063] (3) The results showed that some chickens in the control group began to fall ill on ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a DNA vaccine capable of simultaneously expressing FAdV-4 spike protein 1 and spike protein 2 genes as well as a construction method and application of the DNA vaccine. A specific primer is designed, an overlapping PCR amplification technology is utilized, FAdV-4 spike protein 1 and spike protein 2 genes are connected through a 2A peptide gene to form a fusion gene fibers2A, then the fusion gene fibers2A is inserted into a pCDNA3.1 eukaryotic expression vector, a recombinant plasmid pC-fibers2A is constructed, the recombinant plasmid pC-fibers2A is transformed into escherichia coli DH5alpha, the recombinant plasmid is extracted after amplification culture, and the DNA vaccine is obtained. When the recombinant plasmid is used for an immune test, the result shows that the DNA vaccine can immunize SPF chicken to generate an antibody, the morbidity and mortality are reduced, and the immunoprophylaxis effect is improved.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a DNA vaccine simultaneously expressing FAdV-4 spike protein 1 and spike protein 2 genes, a construction method and application thereof. Background technique [0002] At present, there are 12 serotypes of group I avian adenovirus, among which serotype 4 avian adenovirus (FAdV-4) is the most serious avian adenovirus to the poultry industry in my country. In 2014, pericardial effusion-inclusion body hepatitis syndrome caused by FAdV-4 broke out in chicken flocks in my country, and spread rapidly across the country, causing huge economic losses to my country's chicken industry, but there is still no vaccine available. According to literature reports, the vaccine prepared from the liver of infected chickens through formaldehyde inactivation has good immune protection effect, and the virus inactivated vaccine prepared from chicken liver cancer cell line LMH can also pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/235A61P31/20A61P1/16C12N15/62C12N15/70
CPCA61K39/12A61P31/20A61P1/16C07K14/005C12N15/70A61K2039/53A61K2039/552C12N2710/10222C12N2710/10234C07K2319/00
Inventor 刘青涛李银杨婧黄欣梅赵冬敏韩凯凯刘宇卓章丽娇
Owner JIANGSU ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap