Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live vector vaccine

A technology of Cryptosporidium parvum and live vector vaccines, which is applied in the fields of vaccines, recombinant DNA technology, and the use of vectors to introduce foreign genetic materials. Effects of reducing oocyst discharge, simple preparation method, and convenient use

Pending Publication Date: 2021-08-27
JILIN UNIV
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antigens can be delivered to the host mucosa through oral administration or intranasal drip to stimulate the host’s immune response, but there is no research report on the recombinant invasive lactic acid bacteria live vector vaccine of Cryptosporidium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live vector vaccine
  • Cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live vector vaccine
  • Cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live vector vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Amplification of Gene Cp15 of Cryptosporidium parvum

[0050] Using the cDNA of Cryptosporidium parvum as a template, the Cp15 gene was amplified, and the primers were designed as follows:

[0051] Upstream Cp15F:

[0052] GG ACTAGT TCTGCACTTCTGATCCTAGCTTGTTGGAGCTGCAGTTGCTATGAAATTG;

[0053] Downstream Cp15R:

[0054] CCG CTCGAG TTAATGGTGATGGTGATGATGCTTTAGAGGAATGAATCTGGAAGAA;

[0055] The single-line marks represent restriction sites Spe I and Xho I, respectively. The PCR reaction system is: template 1 μL, upstream primer 1 μL, downstream primer 1 μL, rTaq enzyme 0.5 μL, ddH 2 O 37.5 μL, dNTP 4 μL, 6×Buffer 5 μL. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, and a total of 35 cycles, with a final extension at 72°C for 10 min. The PCR product was separated and identified by 1% agarose gel electrophoresis, and a band of about 432 bp was seen ...

Embodiment 2

[0057] Amplification of Cryptosporidium parvum Gene Cp15-IL-2

[0058] Using the cDNA of Cryptosporidium parvum as a template, the Cp15 gene fragment connected with the flexible fragment Linker was amplified. Upstream Cp15F:

[0059] CGG ACTAGT TCTGCACTTCTGATCCTAGCTTGTTGGAGCTGCAGTTGCTATGAAATTG;

[0060] Downstream Cp15Rlinker:

[0061] AGATCCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACC CTTTAGAGGAATGAATCTGG;

[0062] The underlined marks are the enzyme cutting site Spe I and the linker gene sequence of the flexible linker fragment respectively. The PCR reaction system is: template 1 μL, upstream primer 1 μL, downstream primer Cp15linker 1 μL, rTaq enzyme 0.5 μL, ddH 2 O 37.5 μL, dNTP 4 μL, 6×Buffer 5 μL. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 68°C for 30 s, extension at 72°C for 30 s, and a total of 35 cycles, with a final extension at 72°C for 10 min. The PCR product was separated and id...

Embodiment 3

[0070] Construction of eukaryotic expression vectors of Cp15 and Cp15-IL-2

[0071] Digest the recovered and purified Cp15 and Cp15-IL-2 PCR products and pValac plasmid respectively. The enzyme digestion reaction system is: PCR product / pValac plasmid 16 μL, fast cutting enzyme Spe I and Xho I each 1 μL, 10×Buffer 2 μL . The enzyme digestion reaction conditions were: 37°C, 20 min. The digested products were identified and recovered by 1% agarose gel electrophoresis. Cp15 and Cp15-IL-2 PCR digested products were ligated with pValac vector with DNA ligase. Ligation reaction system: PCR digested product 4 μL, pValac plasmid 4 μL, DNA ligase 1 μL, 10×Buffer 1 μL. The reaction conditions are: 25°C, 2h. The ligation product was transformed into DH5α competent cells, and the positive colonies were screened and cultured with liquid LB. Use the plasmid mini-extraction kit to extract the plasmid according to the instructions and identify it by enzyme digestion. The enzyme digestion p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live vector vaccine. The used lactic acid bacteria are lactic acid bacteria expressing staphylococcus aureus invasive cell key protein FnBPA protein through transformation, and have the capability of delivering DNA. The Cp15 recombinant invasive lactic acid bacteria live vector vaccine for preventing cryptosporidiosis parvum is low in production cost, simple in preparation method and easy to standardize; and the use is convenient. The prepared Cp15 recombinant invasive lactic acid bacteria live vector vaccine for preventing cryptosporidiosis can stimulate cellular immunity and humoral immunity of a host and reduce oocyst discharge by 51.7%, which shows that the vaccine has good immune protection capability on cryptosporidium infection.

Description

technical field [0001] The invention discloses a cryptosporidium parvum Cp15 recombinant invasive lactic acid bacteria live carrier vaccine, which is a novel carrier vaccine for preventing cryptosporidiosis parvum and belongs to the field of biological products. Background technique [0002] Cryptosporidiosis is a worldwide prevalent zoonotic parasitic disease, and its pathogen, Cryptosporidium, can parasitize in mammalian and human intestinal epithelial cells. There are many types of Cryptosporidium, among which the more serious damage is mainly Cryptosporidium parvum ( Cryptosporidium parvum ). At present, there is no ideal way to control Cryptosporidium. Vaccines will be one of the means to prevent and control the disease in the future. At present, scholars at home and abroad have discovered a number of immune protective antigen genes, and carried out their subunit vaccines, nucleic acid vaccines, etc. to study the immune protection against Cryptosporidium, and achieve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/002A61K39/39A61P33/02C12N15/62C12N15/85C12N5/10
CPCA61K39/002A61K39/39A61P33/02C07K14/44C07K14/55C12N15/85A61K2039/523A61K2039/542A61K2039/55533A61K2039/53A61K2039/575C07K2319/00Y02A50/30
Inventor 张楠刘少雄张西臣尹继刚岳涛涛李建华宫鹏涛王晓岑李新
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com