Phagemid vector for displaying exogenous peptide on PVIII protein, and construction method of phagemid vector
A protein display and construction method technology, which is applied in the field of phagemid vectors and its construction for displaying exogenous peptides of PVIII proteins, can solve the problems of high operation requirements, low copy number, low yield, etc., and achieve lower operation requirements and simple operation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The PVIII gene of the phage vector fADL-1e (purchased from Antibody Design laboratories, Catalog number: PD020) was directional cloned into the multi-cloning site EcoR I and HindIII of the prokaryotic expression vector pKK223-3, and a PVIII protein display vector was prepared. The novel phagemid vector pKK8 of the source peptide, its nucleotide sequence is as follows:
[0037] AGCGAAAGACAGCATCGGAACGAG GGTAGCAACGGCTACGGAGGCTTTGAGGACTAAAGACTTTTTTCAT GAGGAAGTTTCCATTAAACGGGTAAAATACGTAATGCCACTACGAA; SEQ ID NO. 1.
[0038] Wherein, the bold part (nucleotide sequence 4558-5020) is the sequence of vector fADL-1e cloned into pKK223-3, and the bold and underlined part (nucleotide sequence 4909-4977) is the reverse of the signal peptide encoding PVIII protein. To the complementary sequence, the part in bold italics (nucleotide sequence 4759-4908) is the reverse complementary nucleotide sequence encoding PVIII protein.
[0039] The preparation steps of the phagemid vector pKK8 a...
Embodiment 2
[0098] Example 2 Functional Verification of Phagemid Vector pKK8
[0099] In order to verify whether the constructed phagemid vector pKK8 has the function of displaying foreign peptides, a key epitope of the P53 protein (MEEPQSDP; SEQ ID NO.5; referred to as peptide MP) is directional cloned into the PVIII gene of pKK8 to form Recombinant phagemid pKK8-MP. The exogenous peptide MP was displayed on the PVIII protein of the phage by means of auxiliary phage infection, and the phage displaying the exogenous peptide was verified by Western blot and observed by atomic force microscope.
[0100] 1) Construction of recombinant phagemid pKK8-MP
[0101] Use the point mutation kit (Vazyme, product number: C215) to construct the recombinant phagemid pKK8-MP, the specific steps are as follows:
[0102] (1) Amplification of vector pKK8
[0103] Use the kit’s own reagents for PCR amplification, and the reaction system is as follows:
[0104]
[0105] The sequences of primers PF2 and...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


