Unlock instant, AI-driven research and patent intelligence for your innovation.

Phagemid vector for displaying exogenous peptide on PVIII protein, and construction method of phagemid vector

A protein display and construction method technology, which is applied in the field of phagemid vectors and its construction for displaying exogenous peptides of PVIII proteins, can solve the problems of high operation requirements, low copy number, low yield, etc., and achieve lower operation requirements and simple operation Effect

Pending Publication Date: 2021-11-12
XINXIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Filamentous phage display technology is mainly related to two coat proteins, one is the PIII protein encoded by gene III, located at the tail of the phage, and has 5 copies. The most prominent advantage of this coat protein is the size of the foreign peptide displayed There are no strict restrictions, but the number of copies is relatively small, and it is often used in the construction of antibody libraries; the other is the PVIII protein encoded by gene VIII, which is located on the back of the phage and has about 2700 copies. The exogenous peptide is displayed on the surface of the phage in the form of an adjuvant, and the body is stimulated to generate a strong immune response against the exogenous peptide displayed, but the system has limitations on the size of the exogenous peptide displayed
[0004] A phage vector is a vector constructed directly using the phage genome as a template. By inserting the foreign peptide into the PIII or PVIII gene of the phage, the foreign peptide is displayed on the surface of the phage, but the phage vector is relatively difficult to prepare and purify. It is cumbersome, and the output is low, and the operation requirements are relatively high
At the same time, for the PVIII display system, since the VIII protein is only 50 amino acids, it is usually only possible to insert shorter peptides (generally not more than 6 amino acids) for direct display using the phage genome, otherwise it will affect the assembly of the phage and reduce the infection ability of the phage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phagemid vector for displaying exogenous peptide on PVIII protein, and construction method of phagemid vector
  • Phagemid vector for displaying exogenous peptide on PVIII protein, and construction method of phagemid vector
  • Phagemid vector for displaying exogenous peptide on PVIII protein, and construction method of phagemid vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The PVIII gene of the phage vector fADL-1e (purchased from Antibody Design laboratories, Catalog number: PD020) was directional cloned into the multi-cloning site EcoR I and HindIII of the prokaryotic expression vector pKK223-3, and a PVIII protein display vector was prepared. The novel phagemid vector pKK8 of the source peptide, its nucleotide sequence is as follows:

[0037] AGCGAAAGACAGCATCGGAACGAG GGTAGCAACGGCTACGGAGGCTTTGAGGACTAAAGACTTTTTTCAT GAGGAAGTTTCCATTAAACGGGTAAAATACGTAATGCCACTACGAA; SEQ ID NO. 1.

[0038] Wherein, the bold part (nucleotide sequence 4558-5020) is the sequence of vector fADL-1e cloned into pKK223-3, and the bold and underlined part (nucleotide sequence 4909-4977) is the reverse of the signal peptide encoding PVIII protein. To the complementary sequence, the part in bold italics (nucleotide sequence 4759-4908) is the reverse complementary nucleotide sequence encoding PVIII protein.

[0039] The preparation steps of the phagemid vector pKK8 a...

Embodiment 2

[0098] Example 2 Functional Verification of Phagemid Vector pKK8

[0099] In order to verify whether the constructed phagemid vector pKK8 has the function of displaying foreign peptides, a key epitope of the P53 protein (MEEPQSDP; SEQ ID NO.5; referred to as peptide MP) is directional cloned into the PVIII gene of pKK8 to form Recombinant phagemid pKK8-MP. The exogenous peptide MP was displayed on the PVIII protein of the phage by means of auxiliary phage infection, and the phage displaying the exogenous peptide was verified by Western blot and observed by atomic force microscope.

[0100] 1) Construction of recombinant phagemid pKK8-MP

[0101] Use the point mutation kit (Vazyme, product number: C215) to construct the recombinant phagemid pKK8-MP, the specific steps are as follows:

[0102] (1) Amplification of vector pKK8

[0103] Use the kit’s own reagents for PCR amplification, and the reaction system is as follows:

[0104]

[0105] The sequences of primers PF2 and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phagemid vector for displaying exogenous peptide on PVIII protein, and a construction method of the phagemid vector, and belongs to the technical field of DNA recombination. The phagemid vector for displaying the exogenous peptide on the PVIII protein is prepared by directionally cloning a filamentous phage PVIII gene to multiple cloning sites of a prokaryotic expression vector pKK223-3. The phagemid vector pKK8 prepared by the invention has the advantages of simplicity in operation, capability of being used for displaying relatively long exogenous peptide and the like on the aspect of displaying the exogenous peptide, the operation requirements of a phage display technology are reduced, and the cross application research of the phage display technology in the subjects of medicine, biology, materials science and the like can be further promoted.

Description

technical field [0001] The invention relates to the technical field of DNA recombination, and more specifically relates to a phagemid vector used for PVIII protein displaying foreign peptides and a construction method thereof. Background technique [0002] Phage display technology is to use phage vector or phagemid vector as a template to insert the gene sequence encoding foreign peptide into the coat protein gene at the gene level, so that the foreign peptide can be displayed on the coat protein of phage. In 1985, Smith first reported in Science the cloning of the endonuclease gene into the coat protein gene III of the filamentous phage, and successfully displayed the enzyme molecule on the PIII protein of the phage. After that, the technology developed rapidly and was widely applied to In various fields, and won the 2018 Nobel Prize in Chemistry. [0003] Filamentous phage display technology is mainly related to two coat proteins, one is the PIII protein encoded by gene I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/66C12N15/10C07K14/00
CPCC12N15/70C12N15/1037C07K14/00
Inventor 殷俊磊程瞾孙伟伟潘鹏涛杨祎洁王振宇刘国燕开悦高姿
Owner XINXIANG UNIV