Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving production capacity of amino acid producing strain

A production capacity, amino acid technology, applied in the field of genetic engineering, can solve the problems of long process lines, high cost, difficult to put into production, etc.

Active Publication Date: 2021-11-12
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The production method of L-proline mainly contains three kinds at present: 1. chemical synthesis method, process circuit is longer, is difficult to put into production (Miao Zhengxing, Zhang Zhongming, Li Baozhong, the production and application of L-proline. Fermentation Technology Communication, 2004( 2): p.35-36.); 2. Extracted from natural protein hydrolyzate, but due to its high cost, it is not suitable for modern industrial production (Cao Zheyu, Zhang Zhenjia, Separation of L-proline from chicken feathers. Amino Acids and Biological Resources, 1986(1):p.1-7.); 3. Direct fermentation method, low raw material cost, mild reaction conditions, easy large-scale production (5374542 Process for producing 4-hydroxy-l-proline: Katsumata Ryoich; Yokoi Haruhiko Machida, Japan Assigned to Kyowa HakkoKogyo Co Ltd. Biotechnology Advances, 1995.13(4): p.719-720. Fang Peijing, Mao Weiying, Chen Qi, L-proline fermentation research. Acta Microbiology, 1982(4) :p.63-70.), become the main way of L-proline production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving production capacity of amino acid producing strain
  • Method for improving production capacity of amino acid producing strain
  • Method for improving production capacity of amino acid producing strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Example 1: Construction of gene putA, gnd mutation and gene gdh enhanced bacterial strain ZQJY-3

[0098] 1. Construction of pk18mobsacB-spec-Peftu-gdh plasmid

[0099] (1) Using primers pk18-kan-zzz-F and pk18-EcoRI-R, using pk18mobsacB as a template, amplify fragment 1 of about 4.3 kb, using primers pk18-crtYf-L and pk18-crtYf-R, using the literature ( The plasmid pJYS3_ΔcrtYf reported in Jiang, Y., et al., Nature Communications, 2017.8) was used as a template to amplify fragment 2 of about 2.1 kb, using primers pk18-HindIII-F and pk18-kan-qdz-R, using pk18mobsacB as a template , to amplify fragment 3 of about 500bp, and use primers pk18-spec-F and pk18-spec-R to amplify about 1.2 Kb spectacle-resistant fragment 4, fragments 1, 2, 3, and 4 were connected by Gibson, transformed into E. coli DH5α competent cells (Shanghai Donghuan Biotechnology Co., Ltd.), and coated with LB-spec plates to obtain plasmid pk18mobsacB-spec_ΔcrtYf .

[0100] (2) Use primers pk18-HindIII...

Embodiment 2

[0114] Embodiment 2: construct the bacterial strain ZQJY-4 of gene zwf inactivation

[0115] 1. Construction of inactivated plasmid pK18mobsacB-ZwfA243T

[0116] Using primers pk18-F and pk18-R, using pK18mobsacB as a template, amplified about 5.6kb vector fragment 11, using primers zwf-aL-F / zwf-aL-R and primers zwf-aR-F / zwf-aR- R used the ATCC 13032 genome as a template to amplify fragments 12 and 13 of about 1 kb, perform Gibson ligation of fragments 11, 12, and 13, and transform DH5α competent cells to obtain plasmid pK18mobsacB-ZwfA243T.

[0117] 2. Prepare ZQJY-3 competent cells.

[0118] The preparation method is the same as step 2 of Example 1.

[0119] 3. Transform plasmid pK18mobsacB-ZwfA243T into ZQJY-3 competent cells

[0120] The conversion method is the same as step 3 of Example 1. After recovery, all the bacteria were spread on the BHIS plate containing kanamycin, and the plate was inverted and cultured in a constant temperature incubator at 30°C for 48 hours...

Embodiment 3

[0123] Example 3: Construction of the bacterial strain ZQJY-6 inactivated by the gene avtA

[0124] 1. Construction of plasmid pJYS2_avtA

[0125] Using primers avtAspc-F and avtAspc-R to amplify the fragment with pJYS2_crtYf as a template, directly transform DH5α competent cells, and coat BHIS solid plates containing spectinomycin to obtain plasmid pJYS2_avtA.

[0126] 2. Synthetic repair template avtA(TAA)59

[0127] The repair template avtA(TAA)59 sequence is:

[0128] CAGAGATCGCTCTTCGCTCGGGTCCTTAATAATACACCGAGGTGATTGGTGATCGTGAG

[0129] 3. Prepare ZQJY-4 competent cells.

[0130] The preparation method is the same as step 2 of Example 1.

[0131] 4. Transform plasmid pJYS2_avtA and repair template avtA(TAA)59 to ZQJY-4 competent cells

[0132] Take 1 μg of the above-mentioned plasmid pJYS2_avtA and 1-10 μg of the repair template avtA(TAA)59, mix them and add them to the competent cells of Corynebacterium glutamicum ZQJY-4, and transfer them to the electroporation cup a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the production capacity of an amino acid producing strain. The method comprises the step of mutating and / or deleting a regulatory region of an odhA gene of an Elo subunit for encoding an alpha-ketoglutarate dehydrogenase compound on a chromosome. By means of the method, the L-proline production capacity of an L-proline production strain can be improved by at least three times, the yield of L-proline produced through fermentation of the constructed engineering strain CCTCC NO: M 2020060 reaches up to 119.90 g / L, and industrial application prospects are achieved.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a method for improving the production capacity of amino acid producing bacteria, in particular to a method for improving the production capacity of L-proline producing bacteria, a kind of L-proline genetic engineering producing bacteria and its application . Background technique [0002] L-proline is a neutral amino acid containing imino groups, one of the 20 basic amino acids that make up proteins, and is a non-essential amino acid for the human body. L-proline has certain physiological activity, is widely used in medicine, agriculture and food industry, especially in the effect in medicine research and treatment, is paid more and more attention to (Thi Mai Hoa, B., et al., Applied Microbiology and Biotechnology, 2013.97(1):p.247-257. List, B., Tetrahedron, 2002.58(28):p.5573-5590.). [0003] The production method of L-proline mainly contains three kinds at present: 1. chemica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/77C12N15/90C12N15/53C12N1/21C12P13/24C12R1/15
CPCC12N15/77C12N15/902C12N9/0008C12P13/24C12Y102/04002
Inventor 钱峰慧董枫张姣蒋宇杨晟
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI