Plant salt tolerance related protein as well as related biological material and application thereof

A biomaterial and salt-tolerance technology, which is applied to plant salt-tolerance-related proteins and related biomaterials and application fields, can solve the problems of reduced absorption, mutants that are not very salt-resistant, and disordered ion absorption by plant roots.

Pending Publication Date: 2022-01-04
INST OF BOTANY CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(2) Ion poisoning is mainly due to the high concentration of Na + and Cl - The balance of sodium and potassium ions is very important for the metabolism of plants. High concentrations of NaCl cause disturbances in the absorption of ions in plant roots, including K + The reduction of absorption and metabolic disturbance will also cause the reduction of photosynthetic efficiency (Deinlein et al.2014; Yang and Guo 2018)
(2) Ion transport, the maintenance of intracellular ion homeostasis is very important for plants to resist salt. Na in cells after salt treatment + Concentration increases to reduce cell damage and deplete harmful Na + Efflux, cells mainly maintain the balance of sodium and potassium ions in the cell through three ways: 1. Through Na + The antiporter SOS1 converts Na + Efflux, the circadian clock GI is involved in rice salt resistance, the interaction between GI and SOS2 inhibits the interaction between SOS2 and SOS3, thereby inhibiting the phosphorylation of SOS1 by SOS2, and the GI protein will be degraded after salt treatment, so that the interaction between SOS2 and SOS3 phosphorylates SOS1 , SOS1 acts as an antiporter to reduce intracellular Na + content (Kim et al.2013); 2. Reduce the intake of sodium ions and increase the intake of potassium ions through the sodium potassium transporter. HKTs family genes are involved in the transport of sodium and potassium ions. Recent studies have found that OsHKT1.5( SKC1) is involved in rice salt resistance. Under salt stress, OsHKT1.5 can effectively transport Na+ from the stem to the root, improving the salt tolerance of rice (Ren et al.2005); 3. Through NHX and other sodium potassium transporters Sodium ion compartmentalization (Yang and Guo 2018), previous studies have found that NHX1 can effectively compartmentalize Na+ in vacuoles, but recent studies have found that NHX is involved in the dual transport of sodium and potassium, and its mutants are not very good Salt resistance (Bassil et al. 2011)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant salt tolerance related protein as well as related biological material and application thereof
  • Plant salt tolerance related protein as well as related biological material and application thereof
  • Plant salt tolerance related protein as well as related biological material and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Embodiment 1, the cloning of the rice oself4a coding gene related to salt tolerance

[0086] 1. Cloning of the gene encoding OsELF4a

[0087] The inventors of the present invention isolated and cloned a rice gene OsELF4a related to salt tolerance from rice Nipponbare, as shown in sequence 1 of the sequence listing, and named its encoded protein OsELF4a protein, as shown in sequence 2 of the sequence listing.

[0088] The total DNA of rice Nipponbare was extracted and amplified by PCR with primers F:ATGGAAGGTGATAGCTTCTCAG and R:CTAGCCGGGCCGGACACGCTTC. The PCR reaction program was: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for 5 min. The PCR products were subjected to Sanger sequencing. Sequencing results show that the nucleotide sequence of the PCR amplification product is sequence 1 in the sequence listing, its coding sequence is the 1st-354th nucleotide o...

Embodiment 2

[0089] Example 2. Application of OsELF4a in Rice Salt Stress Response

[0090] 1. Construction of OsELF4a-deleted mutant rice

[0091] First, use the CDS sequence (coding sequence) of OsELF4a to find the target sequence of CRISPR / Cas9, connect the target sequence to the CRISPR / Cas9 vector by PCR, and then use the method of Agrobacterium-mediated transformation to convert CRISPR / Cas9-OsELF4a The vector was transformed into the rice Nipponbare to obtain the OsELF4a-deleted mutant rice. The specific method is:

[0092] 1) Construction of the carrier

[0093]The DNA sequence shown in Sequence 1 in the sequence listing was used to design the target on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html), and the target ACCACGAGTCCCGGGCGC was obtained. Oligo sequences OsELF4a-OsU3T1F: ggcaACCACGAGTCCCGGGCGC and OsELF4a-OsU3T1R: aaacGCGCCCGGGACTCGTGGT were synthesized. According to literature (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Li...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant salt tolerance related protein as well as a related biological material and application thereof, and provides a salt tolerance related protein derived from rice, which is named as OsELF4a and derived from rice Nipponbare. An experiment for inhibiting the content of the protein in a target plant by utilizing a CRISPR / Cas9 gene editing system shows that compared with the Nipponbare wild type rice, the survival rate of osef4a-1 rice with the function of OsELF4a lost after high-salt hypochondriac stress culture is 30% and is far lower than the survival rate of 70% of the Nipponbare rice, that is, the salt tolerance of the rice can be reduced due to the loss of the function of OsELF4a, which is shown that the OsELF4a is a protein related to the rice tolerance, and specifically, the salt tolerance of the rice without the OsELF4a function can be reduced.

Description

technical field [0001] The invention relates to a plant salt-tolerance-related protein in the field of biotechnology, as well as related biological materials and applications. Background technique [0002] The problem of land salinization is increasing year by year worldwide, causing massive losses to agricultural production, and is a major obstacle to sustainable agricultural development (Tester and Davenport 2003). The salinity in the soil mainly comes from irrigation water and seawater intrusion caused by earthquakes and tsunamis, which contains a large amount of NaCl, which poses a serious threat to crop growth (Deinlein et al.2014; Takagi et al.2015). Plants are divided into tolerant and sensitive according to the tolerance of crops to salt stress. Tolerant crops can survive in lands with a salt concentration exceeding 200m3M, while sensitive crops are difficult to survive in lands with a salt concentration of Survive in the land of 100mM-200mM. Studies have found tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/84C12N5/10A01H5/00A01H6/46
CPCC07K14/415C12N15/8273C12N15/8218
Inventor王雷王希岭魏华
OwnerINST OF BOTANY CHINESE ACAD OF SCI