Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of gherf017 gene in regulating plant salt tolerance

A technology of salt tolerance and genetics, applied in applications, plant peptides, plant products, etc., can solve problems that have not made significant progress

Active Publication Date: 2022-07-08
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a challenging task, the functional identification of cotton genes has not made significant progress (Ashraf et al.2018)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gherf017 gene in regulating plant salt tolerance
  • Application of gherf017 gene in regulating plant salt tolerance
  • Application of gherf017 gene in regulating plant salt tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cloning and Bioinformatics Analysis of Cotton GhERF017 Gene and Promoter

[0040]CottonFGD retrieves the gene sequence of GhERF017, uses NCBI's Primer-Blast website to design primers, and uses PCR (Polymerase Chain Reaction) method to amplify from upland cotton TM-1. The full-length CDS is 429bp, encoding 142 amino acids. The relative protein The molecular weight is 15.6kDa, and the isoelectric point is 7.75. The gene structure shows that the gene contains an exon, the gene contains AP2 domian, and belongs to group II in the gene family (eg figure 1 ).

[0041] Upstream primer F: 5'-ATGGTGAGGCCGATC-3' (SEQ ID NO.1);

[0042] Downstream primer R: 5'-CTAGAAAGTCCAAACACCAGGAGA-3' (SEQ ID NO. 2).

[0043] The open reading frame sequence (SEQ ID NO. 3) is:

[0044] ATGGTGAGGCCGATCGGGGAAAGAGATGACGGCGGCCGTTACAAGGGTGTACGGATGAGGAAGTGGGGGAAATGGGTAGCGGAAGTACGACAACCCAATAGCCGAGGAAGAATATGGTTGGGTTCTTACAAGACAGCAGAAGAAGCTGCTAGAGCTTACGACGCTGCCGTTTTTTGTCTGCGTGGGAATTCGGCAAAGCTTAACTTTCCC...

Embodiment 2

[0048] Expression pattern analysis of GhERF017 under abiotic stress

[0049] Cotton TM-1 variety was planted in the sand in the artificial climate chamber of this subject, and cultivated at a constant temperature of 25 °C, with 16 hours of light and 6 hours of darkness. Cotton grown to the three-leaf stage was treated with 200mmol / L NaCl solution, ddH 2 O as a control, take 0h, 1h, 3h, 6h, 9h, 12h and 24h of cotton root tissue samples; use 20wt% PEG solution treatment, ddH 2 O as a control, take cotton leaf tissue samples of 0h, 1h, 3h, 6h, 9h, 12h and 24h.

[0050] The cotton TM-1 variety was planted in the nutrient soil in the artificial climate chamber of this subject, and cultivated at a constant temperature of 25°C with 16 hours of light and 6 hours of darkness. Cotton leaves were treated with 100 μmol / L ABA and MeJA at the three-leaf stage, and cotton leaf tissues were collected at 0 h, 0.5 h, 1 h, 3 h, 6 h and 9 h. RNA was extracted from tissue samples, reverse trans...

Embodiment 3

[0098] Cloning of GhERF017CDS Sequence

[0099] 1. During the flowering period of cotton, take the mature cotton leaves of cotton TM-1 variety, quick-freeze them in liquid nitrogen, and store them in a -80° refrigerator for later use. RNA was extracted for reverse transcription.

[0100] 2. PCR reaction system, procedure and product detection of gene cloning

[0101] 1) PCR reaction system

[0102] All operations should be carried out on ice. After thawing each component, please mix thoroughly. After use, please put it back to -20℃ for storage.

[0103]

[0104] 2) PCR reaction program

[0105]

[0106] 3) Detection of PCR products

[0107] Take 2 μL of PCR product, add 2 μL of 6×Loading Buffer, mix well, spot on 1% agarose gel, and detect by electrophoresis.

[0108] 3. Gel recovery of PCR products

[0109] 1) After DNA electrophoresis, quickly cut off the gel containing the target DNA fragments under a UV light. It is recommended to use a paper towel to absorb th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention provides a GhERF017 The application of genes in the regulation of plant salt tolerance, GhERF017 The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the amino acid sequence of the encoded polypeptide is shown in SEQ ID NO.4, GhERF017 The gene is used in improving the salt tolerance of plants, and the recombinant plasmid contains GhERF017 Gene fragment, the open reading frame of the gene has the sequence shown in SEQ ID NO.3; the present invention shows that this GhERF017 Genes associated with salt stress, cotton cloned from Upland cotton TM‑1 GhERF017 gene, which constructs a virus-induced silencing complex, infects cotton, and measures the enzymatic activities of malondialdehyde, proline, plant peroxidase and catalase, thereby confirming that silencing this gene reduces cotton Salt tolerance.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to the application of a GhERF017 gene in regulating the salt tolerance of plants. Background technique [0002] Soil salinization is a major abiotic stress affecting global agricultural production (Munns et al. 2015). It is estimated that over 20% of the world's arable land and 50% of irrigated land face the challenge of salinization (Zhu. 2001). Cotton, the most important textile fiber and oil-producing crop in the world, is a salt-tolerant crop, but salinity adversely affects the growth, yield and quality of cotton fibers (Ashraf et al. 2018). This prompted researchers to develop salt-tolerant cotton varieties. In recent years, researchers have made considerable progress in the screening of cotton salt-sensitive genes and the study of molecular mechanisms (Peng et al. 2014). As a challenging task, functional identification of cotton genes has not yet achieved significant progress (...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/60
CPCC07K14/415C12N15/8273Y02A40/146
Inventor 王寒涛张琪喻树迅魏恒玲马亮付小康康萌芦建华
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com