Application of GhERF017 gene in regulation and control of plant salt tolerance
A technology of salt tolerance and genetics, applied in applications, plant peptides, plant products, etc., can solve problems that have not made significant progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Cloning and bioinformatics analysis of cotton GhERF017 gene and promoter
[0040]CottonFGD retrieved the gene sequence of GhERF017, used NCBI's Primer-Blast website to design primers, and used PCR (Polymerase Chain Reaction) method to amplify from upland cotton TM-1. The full length of its CDS is 429bp, encoding 142 amino acids. The molecular weight is 15.6kDa, and the isoelectric point is 7.75. The gene structure shows that the gene contains an exon, the gene contains AP2 domian, and belongs to group II in the gene family (such as figure 1 ).
[0041] Upstream primer F: 5'-ATGGTGAGGCCGATC-3' (SEQ ID NO.1);
[0042] Downstream primer R: 5'-CTAGAAAGTCCAAACACCAGGAGA-3' (SEQ ID NO.2).
[0043] The open reading frame sequence (SEQ ID NO.3) is:
[0044] ATGGTGAGGCCGATCGGGGAAAGAGATGACGGCGGCCGTTACAAGGGTGTACGGATGAGGAAGTGGGGGAAATGGGTAGCGGAAGTACGACAACCCAATAGCCGAGGAAGAATATGGTTGGGTTCTTACAAGACAGCAGAAGAAGCTGCTAGAGCTTACGACGCTGCCGTTTTTTGTCTGCGTGGGAATTCGGCAAAGCTTAACTTTCCCGACAATCCTCC...
Embodiment 2
[0048] Expression pattern analysis of GhERF017 under abiotic stress
[0049] The cotton TM-1 variety was planted in the sand in the artificial climate chamber of this subject, and cultivated at a constant temperature of 25°C, with 16 hours of light and 6 hours of darkness. Cotton growth to the three-leaf stage is treated with 200mmol / L NaCl solution, ddH 2 O as a contrast, get the cotton root tissue samples of 0h, 1h, 3h, 6h, 9h, 12h and 24h; adopt 20wt% PEG solution to process, ddH 2 O as a control, take 0h, 1h, 3h, 6h, 9h, 12h and 24h cotton leaf tissue samples.
[0050] Cotton TM-1 variety was planted in nutrient soil in the artificial climate chamber of this subject, cultivated at a constant temperature of 25°C, with 16 hours of light and 6 hours of darkness. Cotton leaves were treated with 100 μmol / L ABA and MeJA at the three-leaf stage, and cotton leaf tissues were collected at 0h, 0.5h, 1h, 3h, 6h and 9h. RNA was extracted from tissue samples, reverse-transcribed, an...
Embodiment 3
[0098] Cloning of GhERF017 CDS sequence
[0099] 1. At the full flowering stage of cotton, take mature cotton leaves of cotton TM-1 variety, freeze them in liquid nitrogen, and store them in a -80° refrigerator for later use. Extract RNA for reverse transcription.
[0100] 2. PCR reaction system, procedure and product detection of gene cloning
[0101] 1) PCR reaction system
[0102] Please perform all operations on ice. After thawing each component, please mix thoroughly. After use, please return it to -20°C for storage.
[0103]
[0104] 2) PCR reaction program
[0105]
[0106] 3) Detection of PCR products
[0107] Take 2 μL of PCR product, add 2 μL of 6×Loading Buffer, mix well, spot on 1% agarose gel, and detect by electrophoresis.
[0108] 3. Gel recovery of PCR products
[0109] 1) After DNA electrophoresis, quickly cut off the gel containing the target DNA fragment under ultraviolet light. It is recommended to absorb the liquid on the surface of the gel wit...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


