Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of GhERF017 gene in regulation and control of plant salt tolerance

A technology of salt tolerance and genetics, applied in applications, plant peptides, plant products, etc., can solve problems that have not made significant progress

Active Publication Date: 2021-09-10
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a challenging task, the functional identification of cotton genes has not made significant progress (Ashraf et al.2018)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of GhERF017 gene in regulation and control of plant salt tolerance
  • Application of GhERF017 gene in regulation and control of plant salt tolerance
  • Application of GhERF017 gene in regulation and control of plant salt tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cloning and bioinformatics analysis of cotton GhERF017 gene and promoter

[0040]CottonFGD retrieved the gene sequence of GhERF017, used NCBI's Primer-Blast website to design primers, and used PCR (Polymerase Chain Reaction) method to amplify from upland cotton TM-1. The full length of its CDS is 429bp, encoding 142 amino acids. The molecular weight is 15.6kDa, and the isoelectric point is 7.75. The gene structure shows that the gene contains an exon, the gene contains AP2 domian, and belongs to group II in the gene family (such as figure 1 ).

[0041] Upstream primer F: 5'-ATGGTGAGGCCGATC-3' (SEQ ID NO.1);

[0042] Downstream primer R: 5'-CTAGAAAGTCCAAACACCAGGAGA-3' (SEQ ID NO.2).

[0043] The open reading frame sequence (SEQ ID NO.3) is:

[0044] ATGGTGAGGCCGATCGGGGAAAGAGATGACGGCGGCCGTTACAAGGGTGTACGGATGAGGAAGTGGGGGAAATGGGTAGCGGAAGTACGACAACCCAATAGCCGAGGAAGAATATGGTTGGGTTCTTACAAGACAGCAGAAGAAGCTGCTAGAGCTTACGACGCTGCCGTTTTTTGTCTGCGTGGGAATTCGGCAAAGCTTAACTTTCCCGACAATCCTCC...

Embodiment 2

[0048] Expression pattern analysis of GhERF017 under abiotic stress

[0049] The cotton TM-1 variety was planted in the sand in the artificial climate chamber of this subject, and cultivated at a constant temperature of 25°C, with 16 hours of light and 6 hours of darkness. Cotton growth to the three-leaf stage is treated with 200mmol / L NaCl solution, ddH 2 O as a contrast, get the cotton root tissue samples of 0h, 1h, 3h, 6h, 9h, 12h and 24h; adopt 20wt% PEG solution to process, ddH 2 O as a control, take 0h, 1h, 3h, 6h, 9h, 12h and 24h cotton leaf tissue samples.

[0050] Cotton TM-1 variety was planted in nutrient soil in the artificial climate chamber of this subject, cultivated at a constant temperature of 25°C, with 16 hours of light and 6 hours of darkness. Cotton leaves were treated with 100 μmol / L ABA and MeJA at the three-leaf stage, and cotton leaf tissues were collected at 0h, 0.5h, 1h, 3h, 6h and 9h. RNA was extracted from tissue samples, reverse-transcribed, an...

Embodiment 3

[0098] Cloning of GhERF017 CDS sequence

[0099] 1. At the full flowering stage of cotton, take mature cotton leaves of cotton TM-1 variety, freeze them in liquid nitrogen, and store them in a -80° refrigerator for later use. Extract RNA for reverse transcription.

[0100] 2. PCR reaction system, procedure and product detection of gene cloning

[0101] 1) PCR reaction system

[0102] Please perform all operations on ice. After thawing each component, please mix thoroughly. After use, please return it to -20°C for storage.

[0103]

[0104] 2) PCR reaction program

[0105]

[0106] 3) Detection of PCR products

[0107] Take 2 μL of PCR product, add 2 μL of 6×Loading Buffer, mix well, spot on 1% agarose gel, and detect by electrophoresis.

[0108] 3. Gel recovery of PCR products

[0109] 1) After DNA electrophoresis, quickly cut off the gel containing the target DNA fragment under ultraviolet light. It is recommended to absorb the liquid on the surface of the gel wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides application of a GhERF017 gene in regulation and control of plant salt tolerance. A nucleotide sequence of the GhERF017 gene is shown as SEQ ID NO.3, an amino acid sequence of a coding polypeptide is shown as SEQ ID NO.4, the GhERF017 gene is applied in improvement of plant salt tolerance, a recombinant plasmid contains a GhERF017 gene segment, and an open reading frame of the gene has the sequence shown as SEQ ID NO.3. According to the application of the GhERF017 gene in regulation and control of plant salt tolerance, fluorescent quantitative results show that the GhERF017 gene is related to salt stress, the cotton GhERF017 gene is cloned from upland cotton TM-1, the gene constructs a virus-induced silent complex to infect cotton, and enzyme activities of malonaldehyde, proline, plant peroxidase and catalase are measured, and therefore, it is proved that the salt tolerance of cotton is reduced by silencing the gene.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of a GhERF017 gene in regulating plant salt tolerance. Background technique [0002] Soil salinization is a major abiotic stress affecting global agricultural production (Munns et al. 2015). It is estimated that more than 20% of the arable land and 50% of the irrigated land in the world face the challenge of salinization (Zhu. 2001). Cotton, as the world's most important textile fiber and oil-producing crop, is a salt-tolerant crop, but salt has adverse effects on the growth, yield and quality of cotton fibers (Ashraf et al. 2018). This has prompted researchers to breed salt-tolerant cotton varieties. In recent years, researchers have made considerable progress in the screening of cotton salt-sensitive genes and the study of molecular mechanisms (Peng et al. 2014). As a challenging task, the functional identification of cotton genes has not made signifi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/60
CPCC07K14/415C12N15/8273Y02A40/146
Inventor 王寒涛张琪喻树迅魏恒玲马亮付小康康萌芦建华
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com