Pyrus betulaefolia transcription factor PbrWRKY40 and application of pyrus betulaefolia transcription factor PbrWRKY40 in increase of total acid content of plantand genetic improvement of salt resistance

A transcription factor, plant technology, applied in the field of genetic engineering, can solve problems such as limited

Active Publication Date: 2021-05-14
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the reports on the salt-resistance-related transcription factors of Duli pear are very limited. Therefore, the cloning of the salt-resistance-related transcription factors of Duli pear provides an important genetic basis for the selection and transformation of salt-resistant Duli pear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pyrus betulaefolia transcription factor PbrWRKY40 and application of pyrus betulaefolia transcription factor PbrWRKY40 in increase of total acid content of plantand genetic improvement of salt resistance
  • Pyrus betulaefolia transcription factor PbrWRKY40 and application of pyrus betulaefolia transcription factor PbrWRKY40 in increase of total acid content of plantand genetic improvement of salt resistance
  • Pyrus betulaefolia transcription factor PbrWRKY40 and application of pyrus betulaefolia transcription factor PbrWRKY40 in increase of total acid content of plantand genetic improvement of salt resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Cloning of PbrWRKY40 Gene and Construction of Overexpression Vector

[0077] 1. RNA extraction

[0078] The research material, Du pear, was planted in the Pear Engineering Center of Nanjing Agricultural University, and its seedling age was 60 days. Select vigorously growing Du pear seedlings, randomly weigh 0.1g samples, and quickly freeze them with liquid nitrogen. RNA was extracted using the Total RNA Extraction Kit from Solebo, the specific method is as follows:

[0079] (1) Sample processing: Take 0.1g of fresh or -80°C frozen tissue, grind it in liquid nitrogen, add the powder to 1ml of lysate and mix well to obtain a homogenized sample;

[0080] (2) Place the treated sample at room temperature for 5 minutes, so that the nucleic acid protein complex is completely separated;

[0081] (3) Add 0.2 ml of chloroform to the homogenized sample after standing at room temperature, cover the tube cap, shake vigorously for 15 seconds, and place at room temperature for 3 to...

Embodiment 2

[0103] Subcellular localization of the gene encoding the transcription factor PbrWRKY40

[0104] According to the nucleotide sequence of the gene encoding the transcription factor PbrWRKY40 and the pJIT166-GFP vector map, Xba I and BamHI restriction sites were added before and after the gene sequence. The target gene extraction plasmid with correct sequencing results was used as a template, and amplified with primers (SEQ ID NO: 9, ATGGACTACTCAGCTGCATATGATG and SEQ ID NO: 10, ATAAGTATTATGTTGAAGTATTCTTCCTGATATG) with added restriction sites. The PCR program used was: 94°C pre-denaturation for 3 minutes ; Denaturation at 94°C for 30s, annealing at 58°C for 60s, extension at 72°C for 90s, 35 cycles; extension at 72°C for 10min. The stop codon TAG was removed from the 3' of the gene in order to allow the gene to be fused to GFP. After the PCR product was subjected to 1% agarose gel electrophoresis, the target band was recovered using a gel kit. The pJIT166-GFP vector plasmid was...

Embodiment 3

[0108] Genetic Transformation of Arabidopsis

[0109] 1. Plant transformation vector construction

[0110] According to the multiple cloning site of the PCMBIA1300 vector and the coding region sequence of the PbrWRKY40 gene, the restriction site Xba I and BamH I were added, and the upper and lower PCR primers (SEQ ID NO: 9) were designed with primer primer 5.0 software according to the general principle of primer design and SEQ ID NO: 10). Using the clone of the PbrWRKY40 gene as a template, the PCR amplification is carried out with the PCR primers. The annealing temperature for PCR amplification was 58°C, and the PCR reaction system and amplification procedure were the same as those for PbrWRKY40 gene cloning. Gel purification was performed after amplification. The volume of the double enzyme digestion reaction of PCMBIA1300 vector is 40 μl, including: 10 μl of vector plasmid containing PCMBIA1300, 4 μl of 10×M buffer, 1 μl of Xba I and BamHI, and 24 μl of double distilled...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a pyrus betulaefolia transcription factor PbrWRKY40 and application of pyrus betulaefolia transcription factor PbrWRKY40 in increase of total acid content of a plant and genetic improvement of salt resistance, belonging to the technical field of genetic engineering. The salt resistance of an arabidopsis thaliana transformation plant containing a PbrWRKY40 coding gene is obviously higher than the salt resistance of a wild plant, and the content of total acid in the arabidopsis thaliana transformation plant is also obviously higher than the content of total acid in the wild plant; and in addition, the sodium ion content, the conductivity, the hydrogen peroxide content and the superoxide anion content of a positive plant are lower than the sodium ion content, the conductivity, the hydrogen peroxide content and the superoxide anion content of wild arabidopsis thaliana. After the PbrWRKY40 transcription factor in a pyrus betulaefolia seedling is silenced, the salt resistance of a wild pyrus betulaefolia seedling is superior to of the salt resistance of the silenced pyrus betulaefolia seedling, which indicates that the silencing of the PbrWRKY40 transcription factor weakens the salt resistance of the pyrus betulaefolia seedling and reduces the content of total acid in the pyrus betulaefolia seedling. Therefore, the invention provides the application of the pyrus betulaefolia transcription factor PbrWRKY40 in increase of the total acid content of the plant and genetic improvement of .

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the Du pear transcription factor PbrWRKY40 and its application in increasing plant total acid content and salt-resistant genetic improvement. Background technique [0002] Salt stress is a worldwide abiotic stress, and it is one of the main adverse environmental factors that limit crop yields. There are many lands that have been abandoned due to salt damage in the world. Therefore, there is an urgent need to increase crop yields by improving the salt tolerance of crops to meet the growing population needs. Traditional hybrid breeding has a long breeding cycle and slow progress in results. Transgenic breeding has the advantages of short cycle and fast results, and will become the main method of breeding in the future. [0003] Unlike animals, plants cannot move, so plants have to face unfavorable environments such as salt damage, drought, low temperature, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12N15/84A01H5/00A01H6/20A01H6/74
CPCC07K14/415C12N15/8273C12N15/8243
Inventor张绍铃黄小三林立锟黄咏丹董慧珍谢智华齐开杰王亚茹
OwnerNANJING AGRICULTURAL UNIVERSITY