Unlock instant, AI-driven research and patent intelligence for your innovation.

Vacuole-type proton pump pbvha-b1 in Duli pear and its application in genetic improvement of plant salt resistance

A proton pump, pbvha-b1 technology, applied in the field of genetic engineering

Active Publication Date: 2022-04-12
NANJING AGRICULTURAL UNIVERSITY
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, cloning the salt-resistance-related genes of Du pear is the key and foundation of salt-resistant genetic engineering, but there is no report about salt-resistant genes in Du pear in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vacuole-type proton pump pbvha-b1 in Duli pear and its application in genetic improvement of plant salt resistance
  • Vacuole-type proton pump pbvha-b1 in Duli pear and its application in genetic improvement of plant salt resistance
  • Vacuole-type proton pump pbvha-b1 in Duli pear and its application in genetic improvement of plant salt resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Cloning method of full-length cDNA of PbVHA-B1 gene in Du pear

[0059] A vacuolar proton pump PbVHA-B1 was screened from Du pear. According to the sequence of PbVHA-B1 gene and primerpremier 5.0, primers were designed, and its full length was amplified from Du pear by RT-PCR. The detailed steps are as follows: the synthesis of the first strand of cDNA was carried out according to the operating instructions of the TIANGEN reverse transcription kit. The obtained first-strand cDNA was used for PCR amplification of PbVHA-B1 gene. The total reaction volume of the PCR amplification is 50 μl, including 1 μl of pear cDNA, 2.5 μl of upstream and downstream primers, 1 μl of Taq DNA polymerase, 25 μl of Buffer buffer, sterilized ddH 2 O 18 μl. The reaction program of PCR amplification is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 90 s, extension at 72°C for 90 s, 35 cycles, and extension at 72°C for 10 min after the comp...

Embodiment 2

[0062] qRT-PCR Analysis of PbVHA-B1 Encoding Gene Under Different Stress Conditions

[0063] In order to analyze the response mode of PbVHA-B1 gene in Du pear to high salt, dehydration, abscisic acid (ABA) and low temperature treatments, Real-time PCR technology was used to analyze the expression mode of PbVHA-B1 coding gene. The material selected in this experiment is Du pear seedlings, which were cultivated in the National Pear Industry Technology Research Center of Nanjing Agricultural University. The 45-day-old Du pear seedlings with consistent growth and good health were selected and treated with different adversities, and samples were taken at corresponding time points. The samples were quick-frozen with liquid nitrogen and stored in a -80°C ultra-low temperature refrigerator. For salt treatment, the seedlings were treated with 200mM NaCl solution and samples were taken at 0, 1, 6, 12, 24 and 48h; for dehydration treatment, the seedlings were placed on dry filter paper a...

Embodiment 3

[0068] Genetic Transformation of Arabidopsis

[0069] 1. Plant transformation vector construction

[0070] According to the multiple cloning site of the PCMBIA1300 vector and the coding region sequence of the PbVHA-B1 coding gene, the enzyme cutting sites XbaI and BamHI were added, and the upper and lower primers (SEQ ID NO.9) were designed with primerprimier5.0 software according to the general principle of primer design , GAGAACACGGGGGACTCTAGAATGGCTGTTTCACAAAACAATCA and SEQ ID NO. 10, GCCCTTGCTCACCATGGATCCATTAGCTGCATCTCTGCTGTAGAA). PCR amplification was carried out using the clone of the coding gene of PbVHA-B1 as a template. The annealing temperature of PCR amplification was 58°C, and the PCR reaction system and amplification procedure were the same as those for PbVHA-B1 gene cloning. Gel purification and recovery were performed after amplification. The volume of the double enzyme digestion reaction of PCMBIA1300 vector is 40 μl, including: 10 μl of vector plasmid contai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a pear vacuolar proton pump PbVHA‑B1 and its application in genetic improvement of plant salt resistance, belonging to the technical field of genetic engineering. The amino acid sequence of the vacuolar proton pump PbVHA-B1 of Pear pear is SEQ ID No.1, and the nucleotide sequence of its coding gene is SEQ ID No.2. Application of PbVHA-B1 or its coding gene in salt-tolerant plant breeding or breeding transgenic salt-tolerant plants. Using real-time quantitative PCR analysis, the relative expression level of the coding gene increased gradually with the extension of NaCl treatment time within 12 hours, indicating that the coding gene responded to salt stress treatment and had a salt-resistant function. Overexpression of the coding gene can effectively maintain intracellular Na + / K + The balance of concentration can keep the cell osmotic potential stable, so that plants can better adapt to salt stress, while silencing the coding gene can reduce the active oxygen scavenging ability of plants, resulting in weakened salt tolerance of plants.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a vacuolar proton pump PbVHA-B1 of Du pear and its application in genetic improvement of plant salt resistance. Background technique [0002] Pear is one of the main fruit trees planted in the world, and it is the third largest fruit after apple and citrus in China. "Production area layout mode. Although the layout and planning of pear dominant producing areas can well promote the development of my country's pear industry, due to the differences in environmental factors in different regions, the development of pear industry is faced with the impact of salinity, drought, freezing damage, and floods. Therefore, it is very important for the benign and sustainable development of the pear industry to be able to breed good stress-resistant new varieties. Due to the complex genetic background of pear breeding, long childhood, self-incompatibility and other reas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12N15/82A01H5/00A01H6/20A01H6/74
CPCC07K14/415C12N15/8273
Inventor 张绍铃黄小三黄咏丹乔清海董慧珍王春孟林立锟陈紫龄马明谢智华齐开杰
Owner NANJING AGRICULTURAL UNIVERSITY