Vacuole-type proton pump pbvha-b1 in Duli pear and its application in genetic improvement of plant salt resistance
A proton pump, pbvha-b1 technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Cloning method of full-length cDNA of PbVHA-B1 gene in Du pear
[0059] A vacuolar proton pump PbVHA-B1 was screened from Du pear. According to the sequence of PbVHA-B1 gene and primerpremier 5.0, primers were designed, and its full length was amplified from Du pear by RT-PCR. The detailed steps are as follows: the synthesis of the first strand of cDNA was carried out according to the operating instructions of the TIANGEN reverse transcription kit. The obtained first-strand cDNA was used for PCR amplification of PbVHA-B1 gene. The total reaction volume of the PCR amplification is 50 μl, including 1 μl of pear cDNA, 2.5 μl of upstream and downstream primers, 1 μl of Taq DNA polymerase, 25 μl of Buffer buffer, sterilized ddH 2 O 18 μl. The reaction program of PCR amplification is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 90 s, extension at 72°C for 90 s, 35 cycles, and extension at 72°C for 10 min after the comp...
Embodiment 2
[0062] qRT-PCR Analysis of PbVHA-B1 Encoding Gene Under Different Stress Conditions
[0063] In order to analyze the response mode of PbVHA-B1 gene in Du pear to high salt, dehydration, abscisic acid (ABA) and low temperature treatments, Real-time PCR technology was used to analyze the expression mode of PbVHA-B1 coding gene. The material selected in this experiment is Du pear seedlings, which were cultivated in the National Pear Industry Technology Research Center of Nanjing Agricultural University. The 45-day-old Du pear seedlings with consistent growth and good health were selected and treated with different adversities, and samples were taken at corresponding time points. The samples were quick-frozen with liquid nitrogen and stored in a -80°C ultra-low temperature refrigerator. For salt treatment, the seedlings were treated with 200mM NaCl solution and samples were taken at 0, 1, 6, 12, 24 and 48h; for dehydration treatment, the seedlings were placed on dry filter paper a...
Embodiment 3
[0068] Genetic Transformation of Arabidopsis
[0069] 1. Plant transformation vector construction
[0070] According to the multiple cloning site of the PCMBIA1300 vector and the coding region sequence of the PbVHA-B1 coding gene, the enzyme cutting sites XbaI and BamHI were added, and the upper and lower primers (SEQ ID NO.9) were designed with primerprimier5.0 software according to the general principle of primer design , GAGAACACGGGGGACTCTAGAATGGCTGTTTCACAAAACAATCA and SEQ ID NO. 10, GCCCTTGCTCACCATGGATCCATTAGCTGCATCTCTGCTGTAGAA). PCR amplification was carried out using the clone of the coding gene of PbVHA-B1 as a template. The annealing temperature of PCR amplification was 58°C, and the PCR reaction system and amplification procedure were the same as those for PbVHA-B1 gene cloning. Gel purification and recovery were performed after amplification. The volume of the double enzyme digestion reaction of PCMBIA1300 vector is 40 μl, including: 10 μl of vector plasmid contai...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com