Duplex UMI connector and sequencing method
A linker sequence and linker technology, applied in the field of DuplexUMI linker and sequencing, can solve the problems of inability to identify, low sequencing quality value, and low efficiency of repetitive base synthesis, and achieve the effect of shortening the detection cycle and improving the accuracy.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Embodiment 1 Genecast UMI connector preparation
[0081] 1.1 Design and screen 5nt UMIs according to the following principles: ①Consecutive repeats are required to be ≤2 bases; ②The editing distance between any two sequences is required to be ≥2; ③64 sequences per group, 32 of which have the last base as A or T, and the last base of the other 32 sequences is G or C; ④ Every position of 5nt is base balanced, that is, the proportion of A / C / T / G should be 25%±5%. The design results are shown in Table 1.
[0082] Table 1 5nt UMI design results
[0083]
[0084] 1.2 In order to solve the problem of base imbalance caused by AT connection, additional C / G is added after the 32 sequences whose last base is A or T. The design principle: ⑤ Add the same C or G to the complementary sequence at the 3' end. The design results after this treatment are shown in Table 2.
[0085] Table 2 5nt UMI design results after solving the base balance
[0086]
[0087] 1.3 According to the...
Embodiment 2
[0115] Example 2 Detection of human ctDNA
[0116] Take ctDNA (obtained by extraction of human plasma samples) for sample inspection and library building. The detailed library building methods include:
[0117] 1 end repair plus A
[0118] Take 30ng of ctDNA, prepare reaction enzymes and buffer in advance, add water to a total volume of 60 μL, mix well, and incubate in a PCR instrument at 20°C for 30 minutes, and at 65°C for 30 minutes. The reaction system is as follows:
[0119]
[0120] 2 Ligation reactions
[0121] Add the following reagents sequentially to the mixture 1 after end repair & add A, mix well, and incubate in a PCR machine at 20°C for 15 minutes.
[0122]
[0123] 3 Purification after ligation: Purify the ligation product with 0.8× magnetic beads and dissolve it in 22 μL of water.
[0124] 4 Library construction: Add the reagent preparation mixture to the PCR tube in sequence according to the following requirements.
[0125]
[0126] Mix the liquid ...
Embodiment 3
[0141] Example 3 Phix DNA detection
[0142] The adapter prepared in Example 1 was used to detect Phix bacterial DNA, and the detection method was the same as in Example 2. Phix bacterial DNA is mimicked with the following sequence:
[0143] The sense strand sequence is:
[0144] CAAGCTAGGTTCAACTGTCGTAACGCTATTCACTTCAACCTAGTGTGCGAA,
[0145] The antisense strand sequence is:
[0146] TCGCACACTAGGTTGAAGTGAATAGCGTTACGACAGTTGAACTCTAGCTTGA.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More