Vector for targeting EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell strain and application

A non-small cell lung cancer and fusion gene technology, applied in the direction of tumor/cancer cells, animal cells, gene therapy, etc., can solve problems affecting the expression of EML4 and ALK genes

Pending Publication Date: 2022-03-01
湖南亚大丰晖新材料有限公司
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since EML4-ALK is a gene fusion caused by gene translocation, conventional gene editing strategies targeting EML4 and ALK will affect the expression of normal EML4 and ALK genes while targeting variant 1 of the EML4-ALK fusion gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector for targeting EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell strain and application
  • Vector for targeting EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell strain and application
  • Vector for targeting EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Identification of EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell line NCI-H3122

[0044] 1.1 Genome Extraction

[0045] Genome extraction kit (purchased from Tiangen, Cat. No. DP304-03) was used to extract the genome of normal human non-small cell lung cancer cell line NCI-H3122 according to the instructions.

[0046] 1.2 Genome PCR

[0047] Designing Genome Amplification Primers

[0048] EML4-ALK-GF1:TTCTGGCATGTGCAAGAAGT (SEQ ID NO.4)

[0049] EML4-ALK-GR1:ACCTGGCCTTCATACACCTC (SEQ ID NO.5)

[0050] EML4-ALK-GF2: GTTATCACAGCACCGCAGAC (SEQ ID NO. 6)

[0051] The NCI-H3122 genome was amplified with EML-ALK-GF1 and EML-ALK-GR1, and the amplified DNA product was identified by gel electrophoresis, as shown in the identification diagram figure 1 shown. The PCR products were sequenced with EML4-ALK-GF1 and EML4-ALK-GF2 respectively, and the sequencing results were compared with the expected recombinant genome sequence. The comparison...

Embodiment 2

[0052] Embodiment 2 Targeting the vector construction of EML4-ALK fusion gene variant 1

[0053] 2.1 Screening for suitable EML4-sgRNA target sequence fragments

[0054] 2.1.1 Selection of EML4-sgRNA target sites

[0055] According to the genome sequence of human EML4 intron 11 sequenced in Example 1, refer to the sgRNA target site design website, and select 3 target sites for testing. The test sequence is as follows:

[0056] EML4-sg1:5`-TGCTACTTACAATTAACGAT-3`;

[0057] eml4-sg2:5`-GCTACTTACAATTAACGATA-3`;

[0058] EML4-sg3:5`-CAGATTGTTTTAATGTCATT-3`.

[0059] 2.1.2 EML4-sgRNA target site screening

[0060] Using the gRNA activity fluorescent detection kit (purchased from Beijing Hopson Gene, Cat. No. HS-SR-0001A), the detection vector was constructed according to the operation steps of the product manual, and the cell experiment was carried out. Experimental results such as image 3 As shown (high fluorescence ratio of No. 1 and No. 2 targets, low fluorescence ratio ...

Embodiment 3

[0093] Example 3 Knockout and screening of EML4-ALK fusion gene variant 1 in human non-small cell lung cancer cell line NCI-H3122

[0094] 3.1 Culture NCI-H3122 cells

[0095] Resuscitate and culture NCI-H3122 cells. The formulation of the cell culture medium is shown in Table 3 below:

[0096] Table 3. NCI-H3122 cell complete medium composition table

[0097]

[0098] 3.2 Cell transfection

[0099] In the present invention, Hanbio’s transfection reagent (article number: HB-TRLF-1000) was used to transfect according to the steps in the product instructions (NC-sgRNA-Cas9, control plasmid, without sg target; EML4-ALK-sgRNA- Cas9 with targets for EML4 and ALK, respectively). On the third day after transfection (after 72 hours), observe the proportion of cells with green fluorescence. In the field of microscope, the more cells with positive green fluorescence ratio and the stronger the green fluorescence, the higher the transfection efficiency.

[0100] 3.3 Puromycin scre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biology, in particular to a vector of an EML4-ALK fusion gene variant 1 in a targeted human non-small cell lung cancer cell strain and application of the vector. The vector is a lentiviral vector comprising a green fluorescent gene EGFP, a puromycin resistance gene, a Cas9 protein coding gene and sgRNA target spots and other functional elements aiming at EML4 and ALK respectively. The vector can specifically influence the expression of the EML4-ALK fusion gene variant 1 without influencing the normal expression of EML4 and ALK genes, and can be used for treating related diseases caused by the EML4-ALK variant 1 in clinic.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a carrier targeting human non-small cell lung cancer cell line EML4-ALK fusion gene variant 1 and its application. Background technique [0002] Lung cancer is one of the most common causes of death worldwide, with non-small cell lung cancer (NSCLC) being a leading cause of death. In the past, most patients were diagnosed as late-stage disease, and generally they could only be treated conservatively. Identifying the molecular mechanism of pathogenesis and carrying out targeted treatment are of great benefit to the improvement and prevention of lung cancer clinical treatment. [0003] In 2007, in a clinical study of non-small cell lung cancer (NSCLC) in Japan, it was found that some patients had a fusion of anaplastic lymphoma kinase (ALK) and echinodermal microtubule-associated protein-like protein 4 (EML4), which could express an unconventional transformation Fusion kinases can be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/62C12N15/64C12N5/10A61K48/00A61P35/00
CPCC12N15/85C12N9/12C07K14/47C12N15/64C12N5/0693C12N5/0688A61K48/0008A61K48/005A61P35/00C07K2319/60C12N2510/00
Inventor 蒋明贵刘彩云屈飞
Owner 湖南亚大丰晖新材料有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap