Supercharge Your Innovation With Domain-Expert AI Agents!

Method for fixed-point quantitative detection of cancer marker based on micro-fluidic chip

A cancer marker and microfluidic technology, applied in chemical instruments and methods, measuring devices, laboratory containers, etc., can solve the problems of low precision, time-consuming analysis, etc., to meet the detection accuracy and save the amount of solution , Reduce the effect of sample consumption

Pending Publication Date: 2022-03-18
TIANJIN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The invention provides a method for fixed-point quantitative detection of cancer markers based on a microfluidic chip, which solves the problems of time-consuming analysis and low precision in the traditional method for detecting cancer markers in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fixed-point quantitative detection of cancer marker based on micro-fluidic chip
  • Method for fixed-point quantitative detection of cancer marker based on micro-fluidic chip
  • Method for fixed-point quantitative detection of cancer marker based on micro-fluidic chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments, but the present invention is not limited.

[0030] A microfluidic chip provided by the present invention is applied to the detection method of ovarian cancer marker CA125 in serum samples, which can realize preliminary screening of ovarian cancer according to the detection of CA125 content in serum, including the following steps:

[0031] The specific implementation process is as follows:

[0032] A method for detecting ovarian cancer markers in serum samples using a microfluidic chip, comprising the following steps:

[0033] 1. Design and detect the corresponding aptamer

[0034] (1) CA125 recognition strand: 5'-biotin-agttgccacc ttaagactca ctatagggag acaagaataaacgctcaagt cta-6-Carboxytetramethylrhodamine (TAMRA)-3' (SEQ ID No.1), which is a hairpin DNA with 54 deoxyribonucleotides in length, The CA125 recognition chain, the sequence that sp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for fixed-point quantitative detection of a cancer marker based on a micro-fluidic chip, a PDMS channel is composed of six concentration gradient to-be-detected substance channels formed by bifurcating after two inlets, an S-shaped curve channel is adopted for uniform mixing, and in order to reduce dead volume caused by a right angle, an arc is adopted at the joint; the micro-fluidic chip is formed by bonding PDMS and glass, and the PDMS is provided with a micron-sized channel, so that the reagent cost is greatly reduced, the integration degree is high, and the micro-fluidic chip has the potential of automatic batch production and portable detection; a PDMS brush printing method is adopted for modification of amino groups of the microfluidic channel, and brushes are designed at unequal intervals, so that fixed-point modification, comparison and observation are facilitated; the biotin-modified aptamer can be connected with streptavidin, the fluorescence brightness on the aptamer can reflect the concentration of the connected aptamer, the aptamer is quenched by a BHQ fluorescence quenching agent along with fluorescence, then a to-be-detected substance combined with the aptamer is added, and the concentration of the to-be-detected substance is judged according to the recovery degree of the fluorescence intensity. And the detection of'on-off-on 'is realized. The method can meet the requirements of simultaneously detecting various cancer markers and realizing trace and accurate detection of the cancer markers.

Description

technical field [0001] The invention belongs to the field of cancer marker detection, and in particular relates to a new type of microfluidic chip and the layer-by-layer modification of the chip, and the use of the modified chip to quantitatively detect various cancer markers by using fluorescence intensity to realize the combination of various cancer markers. method of detection. Background technique [0002] Serum levels of CA125, HE4, and CEA are closely related to the occurrence and development of epithelial ovarian cancer. Joint detection of CA125, HE4, and CEA is of great significance for early diagnosis, disease development monitoring, and prognosis evaluation of epithelial ovarian cancer [1] . In clinical trials, cancer marker levels are often measured radiologically [2] and enzyme immunoassay [3] to measure. These traditional analyzes are time-consuming and require laboratories with special equipment. In recent decades, several methods for the detection of canc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/64B01L3/00
CPCG01N21/6428G01N21/6486B01L3/502707G01N2021/6432B01L2200/027B01L2200/10
Inventor 胡畅谭硕李爽兰颖明东
Owner TIANJIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More