Tumor specific promoter and application thereof

A promoter and promoter element technology, applied in the field of tumor-specific promoters, can solve problems such as difficult to obtain good results and limited activity, and achieve the effect of inhibiting tumor growth and improving the function of tumor-specific promoters

Pending Publication Date: 2022-07-05

SICHUAN UNIV

0 Cites 0 Cited by

AI-Extracted Technical Summary

Problems solved by technology

Therefore, the promoter of telomerase can be used as a tumor-specific promoter for oncolytic adenovirus therapy. Existing studies have shown that the...

Method used

After pDC316 plasmid is digested with restriction endonuclease XbaI and HindIII, then hTERT WT and mhTERT (optimum promoter L-DT-E2F down (SEQ ID No.12) in embodiment three), respectively E1A/E1B-19K (nucleotide sequence shown in SEQ ID No.18) necessary for the propagation of adenovirus was connected to the digested pDC316 plasmid to construct pDC316-hTERT and pDC316-mhTERT, between hTERT and E1A An EcoRI restriction site was added for verification.

[0054] The present invention has carried out a lot of creative work to enhance the intratumoral proliferation ability of oncolytic virus, especially the tumor-specific proliferation ability. Surprisingly, the present invention finds that a high-efficiency tumor-specific promoter can be obtained by specific modification of the hTERT promoter. Of course, this promoter can also be used in other fields besides the preparation of oncolytic adenoviruses, such as for the preparation of reverse expression plasmids, for the preparation of other oncolytic viruses, such as oncolytic parvovirus, oncolytic herpes virus, oncolytic Oncopox virus, oncolytic vesicular stomatitis virus, oncolytic measles virus, oncolytic myxoma virus, oncolytic retrovirus, oncolytic reovirus, oncolytic vaccinia virus, etc.

[0056] Further, the present invention uses a truncated 181bp core promoter segment (SEQ ID No.1), which is subjected to a C69T mutation and/or a C47T mutation corresponding to the wild type. First, it was found that this segment has a promoter function and can initiate the expression of luciferase in various tumor cells. The promoter activity of the 181bp core promoter segment of C69T mutation (SEQ ID No.3), C47T mutation (SEQ ID No.4) and DT double mutation (SEQ ID No.5) is significantly improved, especially The 181bp core promoter segment of the DT double mutation has the strongest promoter activity....

Abstract

The invention belongs to the field of tumor immunotherapy, and particularly relates to a tumor specific promoter and application thereof. The technical problem to be solved by the invention is that the tumor specific multiplication capacity of the oncolytic adenovirus is limited. According to the scheme for solving the problems, the core promoter is provided, has the function of independently promoting gene expression, can be independently used as a promoter and can also be used as a component construction promoter. The nucleotide sequence of the gene is as shown in SEQ ID No. 1; or a nucleic acid molecule which is obtained by inserting, deleting and/or replacing one or more basic groups in the nucleotide sequence as shown in the sequence SEQ ID No.1 and still has the promoter function, wherein the nucleotide sequence is obtained by inserting, deleting and/or replacing one or more basic groups in the nucleotide sequence as shown in the sequence SEQ ID No.1. The modified tumor specific promoter has a better tumor specific promoter function, and the oncolytic adenovirus constructed by the promoter has the characteristic of being capable of specifically proliferating in tumor cells but not proliferating in normal cells, and is an excellent immunotherapy drug aiming at various tumors.

Application Domain

VectorsTransferases +8

Technology Topic

Gene expressionTumor specific +14

Image

Examples

Experimental program(6)

Example Embodiment

[0073] Example 1 Detection of mRNA expression of human telomerase reverse transcriptase in different human cells

[0074] The cells used in this example are human-derived normal cells, human embryonic lung fibroblasts MRC-5 (ATCC: CCL-171) and human primary skin fibroblasts PCS-201-010 (ATCC: PCS-201-010 TM), human tumor cells: malignant glioblastoma cells U87MG (ATCC: HTB-14), malignant melanoma cells A375 (ATCC: CRL-1619), lung cancer cells A549 (ATCC: CRM-CCL-185), breast cancer cells Cells MCF-7 (ATCC: HTB-22), cervical cancer cells Hela (ATCC: CRM-CCL-2) and ovarian cancer cells SKOV3 (ATCC: HTB-77). Cells were harvested, and total cellular RNA was extracted and reverse transcribed into cDNA. The expression of human telomerase reverse transcriptase was detected by RT-PCR, and GAPDH was used as an internal reference.

[0075] The result is shown ( figure 1 ), in normal cells MRC-5 and PCS-201-010, human telomerase reverse transcriptase was almost not expressed, while in tumor cells of 6 different tumor origins, human telomerase reverse transcriptase was highly expressed.

Example Embodiment

[0076] Example 2 Detection of hTERT promoter mutation in different human tumor cells

[0077] The tumor cells U87MG, A375, A549, MCF-7, Hela and SKOV3 were collected, the cell genome was extracted, and the hTERT promoter nucleic acid sequence was sequenced.

[0078] experiment result shows( figure 2 ): In U87MG cells, there are partial C69T and C47T double mutations in the hTERT promoter; in A375 cells, there is a C69T mutation; in other cells, there is no mutation in the hTERT promoter. Therefore, it was considered whether these mutations could be applied to the promoter optimization of oncolytic adenovirus and the improvement of oncolytic effect.

Example Embodiment

[0079] Example 3 Preliminary optimization of hTERT promoter

[0080] 1. Construction of hTERT promoter point mutation

[0081] This example uses the -378-+77 region sequence of the hTERT promoter (from the TERT 5' regulatory region of human chromosome 5, sequence ID: NG_055467.1), a total of 455 bp, marked as hTERT WT ( image 3 The winning bid is L-WT) sequence (SEQ ID No. 2) (see image 3 ). By studying its sequence, the segment containing 181 bp from -181 to +77 was selected as the core region with strong promoter activity, which was marked as 181-WT sequence (SEQ ID No. 1) (see image 3 ). image 3 Where +1 represents the first nucleotide in the mRNA sequence, and -1 represents the first 5' nucleotide to the transcription start site. Both C69T (nucleotide C at -69) and C47T (nucleotide C at -47) indicate that the hTERT promoter sequence has a single cytosine C to thymine T mutation. DT indicated that the sequence had the above-mentioned double mutation of C→T at positions -47 and -69. The relevant nucleic acid sequences are shown in Table 1:

[0082] Table 1. Various hTERT promoter nucleic acid sequences

[0083]

[0084]

[0085]

[0086] The pGL3-basic plasmid (purchased from Microbix Biosystems Inc) can be used for the detection of promoter activity, that is, the multiple cloning site region is located upstream of the firefly luciferase gene. After the pGL3-basic plasmid was digested with restriction enzymes XhoI and HindIII, the above-mentioned hTERT WT, 181-WT, 181-C69T, 181-C47T, 181-DT, L-C69T, L-C47T and L -DT fragments were ligated with the digested pGL3-basic, respectively, and constructed as pGL3-L-WT, pGL3-181-WT, pGL3-181-C69T, pGL3-181-C47T, pGL3-181-DT, pGL3-L- C69T, pGL3-L-C47T and pGL3-L-DT were sequenced correctly.

[0087] 2. Detection of hTERT point mutation promoter activity

[0088] The pGL3-basic plasmid carries the firefly luciferase gene, which can be used to detect the activity of the promoter. 96-well plates were spread into U87MG 1.5×10 per well 4 cells, A375 1.5 × 10 per well 4 cells, 1 × 10 per well for MRC-5, PCS-201-010, A549, MCF-7, Hela, and SKOV3 4 cells were cultured at 37°C overnight.

[0089] Grouping: (1) Control

[0090] (2) pGL3-basic (100ng)+pRL-TK (internal reference plasmid 10ng)

[0091] (3) pGL3-L-WT (100ng)+pRL-TK (internal reference plasmid 10ng)

[0092] (4) pGL3-L-C69T (100ng)+pRL-TK (internal reference plasmid 10ng)

[0093] (5) pGL3-L-C47T (100ng)+pRL-TK (internal reference plasmid 10ng)

[0094] (6) pGL3-L-DT (100ng)+pRL-TK (internal reference plasmid 10ng)

[0095] The plasmids in the above groups were transfected into each cell with Lipofectamine 3000 for 24 hours and the double fluorescence was detected. Note: pRL-TK is the HSV TK promoter to promote the expression of Renilla luciferase, and pCMV-TK is the CMV promoter to promote the expression of Renilla luciferase. The internal reference plasmid used for MRC-5 and PCS-201-010 was pCMV-TK.

[0096] The result is displayed (such as Figure 4 ), in normal cells MRC-5 and PCS-201-010 cells, almost no firefly luciferase was detected. In tumor cells, the L-DT double-mutated promoter activity was significantly higher than that of the L-WT sequence, indicating that the hTERT WT promoter (-378~+77) double-mutated the activity was significantly enhanced.

[0097] 3. Detection of hTERT point mutation core promoter element promoter activity

[0098] To further test the promoter activity of the core region of the truncated 181bp core promoter element, 96-well plates were plated into U87MG at 1.5×10 per well. 4 cells, A375 1.5 × 10 per well 4 cells, 1 × 10 per well for MRC-5, PCS-201-010, A549, MCF-7, Hela, and SKOV3 4 cells were cultured at 37°C overnight.

[0099] Grouping: (1) Control

[0100] (2) pGL3-basic (100ng)+pRL-CMV (internal reference plasmid 5ng)

[0101] (3) pGL3-L-WT (100ng)+pRL-CMV (internal reference plasmid 5ng)

[0102] (4) pGL3-181-WT (100ng)+pRL-CMV (internal reference plasmid 5ng)

[0103] (5) pGL3-181-C69T (100ng)+pRL-CMV (internal reference plasmid 5ng)

[0104] (6) pGL3-181-C47T (100ng)+pRL-CMV (internal reference plasmid 5ng)

[0105] (7) pGL3-181-DT (100ng)+pRL-CMV (internal reference plasmid 5ng)

[0106] The plasmids in the above groups were transfected into each cell with Lipofectamine 3000 for 24 hours and the double fluorescence was detected. Note: pCMV-TK is the CMV promoter to promote the expression of Renilla luciferase.

[0107] The result is displayed (such as Figure 5 ), in normal cells MRC-5 and PCS-201-010 cells, almost no firefly luciferase was detected. In tumor cells, compared with the 181-WT sequence, the promoter activity of the 181-DT double mutation was significantly increased, indicating that the promoter activity was significantly enhanced after the double mutation of the 181bp core promoter element.

[0108] 4. Further optimization of hTERT double mutant promoter

[0109] The E2F-1 promoter has also been reported in the art for oncolytic adenovirus therapy and can selectively proliferate in Rb-deficient cells. The E2F binding site on the E2F-1 promoter is a key site involved in the binding of the E2F-RB complex, and the nucleic acid sequence of the E2F binding site is TCGGCGGCTCGTGGCTCTTTCGCGGCAAAAAGGATTTGGCGCG TAAAAGTGG (SEQ ID No. 15). The present invention considers that it may further enhance its activity by cooperating with the hTERT promoter. The present invention inserts the E2F binding site between -181bp and -182bp on the basis of L-WT and L-DT to form E2F up, and inserts +4bp to + E2Fdown is formed between 5bp, and E2F up+down is formed by inserting between the two sites (see Table 1 and image 3 ). The pGL3-basic plasmid was digested with restriction enzymes XhoI and HindIII, and then image 3 The indicated L-WT-E2F up, L-WT-E2F down, L-WT-E2F up+down, L-DT-E2F up, L-DT-E2F down and L-DT-E2F up+down fragments and enzymes The cut pGL3-basic ligation was constructed as pGL3-L-WT-E2F up, pGL3-L-WT-E2F down, pGL3-L-WT-E2F up+down, pGL3-L-DT-E2Fup, pGL3-L -DT-E2F down and pGL3-L-DT-E2F up+down, sequenced correctly.

[0110] 96-well plates were spread into U87MG 1.5×10 per well 4 cells, A375 1.5 × 10 per well 4 cells, 1 × 10 per well for MRC-5, PCS-201-010, A549, MCF-7, Hela, and SKOV3 4 cells were cultured at 37°C overnight.

[0111] Grouping:

[0112] (1)Control

[0113] (2) pGL3-basic (100ng)+pRL-TK (internal reference plasmid 10ng)

[0114] (3) pGL3-L-WT (100ng)+pRL-TK (internal reference plasmid 10ng)

[0115](4) pGL3-L-WT-E2F down (100ng)+pRL-TK (internal reference plasmid 10ng)

[0116] (5) pGL3-L-WT-E2F up (100ng)+pRL-TK (internal reference plasmid 10ng)

[0117] (6) pGL3-L-WT-E2F up+down (100ng)+pRL-TK (internal reference plasmid 10ng)

[0118] (7) pGL3-L-DT (100ng)+pRL-TK (internal reference plasmid 10ng)

[0119] (8) pGL3-L-DT-E2F down (100ng)+pRL-TK (internal reference plasmid 10ng)

[0120] (9) pGL3-L-DT-E2F up (100ng)+pRL-TK (internal reference plasmid 10ng)

[0121] (10) pGL3-L-DT-E2F up+down (100ng)+pRL-TK (internal reference plasmid 10ng)

[0122] The plasmids in the above groups were transfected into each cell with Lipofectamine 3000 for 24 hours and the double fluorescence was detected. The internal reference plasmid used for MRC-5 and PCS-201-010 was pCMV-TK 50ng, and the internal reference plasmid used for other tumor cells was pRL-TK10ng.

[0123] The result is displayed (such as Image 6 ), in normal cells MRC-5 and PCS-201-010 cells, almost no firefly luciferase was detected, but Renilla luciferase could be detected. In tumor cells, the promoter activity of pGL3-L-DT E2F down was significantly increased compared with that of pGL3-L-DT sequence, but not in pGL3-L-DT-E2F down and pGL3-L-DT-E2F up+down. There is a significant difference, so the L-DT-E2F down sequence was selected as the optimal promoter sequence in the subsequent experiments, marked as mhTRET, with a total of 504bp (SEQ ID No. 12).

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

Classification and recommendation of technical efficacy words

inhibit tumor growth

Tumor specific promoter and application thereof

A promoter and promoter element technology, applied in the field of tumor-specific promoters, can solve problems such as difficult to obtain good results and limited activity, and achieve the effect of inhibiting tumor growth and improving the function of tumor-specific promoters

AI-Extracted Technical Summary

Problems solved by technology

Method used

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Targeting chimera for degrading ERK1/2 protein and application thereof

Application of GSK126 in preparation of medicine for treating oxaliplatin drug-resistant colon cancer

Heterogeneous CIC cell model of targeted adhesion molecule and preparation method thereof

Magnesium alloy bone splint capable of resisting bacteria and inhibiting tumor proliferation and preparation method

CAR-T cell targeting AXL and preparation method and application thereof

Classification and recommendation of technical efficacy words

Application of bacteroides fragilis in preparing composition for preventing and treating colon cancer

Targeted drug delivery system for brain glioma as well as preparation method and use thereof

Novel specific inhibitor of the cyclin kinase inhibitor p21Waf1/Cip1 and methods of using the inhibitor

Nano-hydroxyapatite composite material with tumor inhibiting effect and preparation method thereof

Application of ambroxol to preparation of tumor chemotherapy drug synergistic agent