Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescence self-quenching primer as well as design method and application thereof

A design method and self-quenching technology, applied in the field of fluorescent PCR, can solve the problems of self-quenching primer background signal enhancement, inability to perform melting curve analysis, insufficient ability to detect mutations, etc., to improve sensitivity and accuracy, reduce design Difficulty, the effect of reducing synthesis cost and difficulty

Active Publication Date: 2022-08-09
广州博懿瑞生物科技有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The multiplex PCR technology based on the fluorescent probe method refers to the addition of multiple pairs of primers while adding specific probes with different fluorescent labels during multiplex PCR amplification. The two ends of the probes are respectively labeled with different fluorescent groups and The quenching group relies on the 5'→3' exonuclease activity of DNA polymerase to digest and hydrolyze the probe during the PCR amplification process, so that the fluorescent group and the quenching group are separated, thereby generating different fluorescent signals. Finally, the detected substances are distinguished according to the difference of the fluorescence signal; the disadvantage is that the same fluorescent channel cannot distinguish different detection substances, the ability to detect mutations is insufficient, and the melting curve analysis cannot be performed
The multiple PCR detection method based on fluorescent dyes refers to adding fluorescent dyes during multiple PCR amplification, and then performing melting curve analysis, and distinguishing the corresponding detection substances according to the different TM values ​​of different detection substances. The disadvantage is that only single channel can be performed. detection, prone to non-specific
[0003] Consult relevant domestic and foreign patents and documents based on self-quenching fluorescent primer detection technology. At present, there are patents and documents based on self-quenching fluorescent primers or probes. The prior art Neisseria gonorrhoeae fluorescent quantitative PCR detection kit introduces A self-quenching primer, the self-quenching primer is a primer with a neck loop structure, the 5 bases at the 3' end of the primer will pair with the bases at the 5' end, and the second base at the 3' end (T base base) is labeled with FAM fluorescein; however, the combination of the G base and the C base pair in the neck loop structure of the self-quenching primer will greatly reduce the quenching performance of the G base, so that the background signal of the self-quenching primer itself Enhanced, which increases the difficulty of detection; and when the self-quenching primer is used for PCR detection, it cannot be used for melting curve analysis, because the primer itself has a double-stranded structure, which will release a fluorescent signal, resulting in a non-specific melting curve. ; At the same time, the self-quenching primer has obvious secondary structure, which will affect the amplification efficiency of PCR
The prior art (Zhang Y, Wei Y, Yang S, et al. Rapid and accurate identification of SARS-CoV-2 variants containing E484 mutation. 2021.) discloses the principle of using guanine self-quenching, but it is prepared using this principle The self-quenching TaqMan fluorescent probe is a self-quenching probe fluorescent PCR technology. This method requires additional design of TaqMan probes, which increases the difficulty of design; at the same time, this method cannot perform melting curve analysis, and Taq enzymes will Hydrolyzed, will not form a double-stranded product with a fluorescent signal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence self-quenching primer as well as design method and application thereof
  • Fluorescence self-quenching primer as well as design method and application thereof
  • Fluorescence self-quenching primer as well as design method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Design of primers for self-quenching fluorescence

[0068] 1. Design method of primers for self-quenching fluorescence

[0069] (1) Design corresponding upstream primers and downstream primers according to the gene sequence of the substance to be tested;

[0070] (2) search for "TG" base or "GT" base or "CG" base or "GC" base in the sequence of upstream or downstream primer;

[0071] (3) Labeling a fluorescent dye on the T or C base in the "TG" base or the "GT" base or the "CG" base or the "GC" base.

[0072] 2. The specific method of primer design for self-quenching fluorescence

[0073] Select primers that have been designed for the gene of the substance to be tested, the primer sequence is 16-30 bases, look for the "TG" base or "GT" base or "CG" base in the upstream primer or downstream primer sequence, and then Label the corresponding fluorescent dye on the T base or C base to obtain a self-quenching fluorescence primer. The fluorescent dye is labeled ...

Embodiment 2

[0075] Embodiment 2 A kind of PCR detection method based on the primer of self-quenching fluorescence

[0076] 1. Extract nucleic acid from the sample

[0077] Extract and purify nucleic acid from the sample using a nucleic acid extraction kit.

[0078] 2. PCR system preparation

[0079] (1) Reaction system of DNA fluorescence PCR

[0080] 10×PCR Buffer (Mg 2+ plus), 2.5 μL; dNTPs (10 mM each, containing dUTP), 1 μL; self-quenching fluorescence primers (10 pmol / μl), 0.3 μL to 1 μL; downstream / upstream primers (10 pmol / μl), 0.3 μL to 1 μL; DNA Polymerase (5U / μl), 0.5 μL; UDG enzyme (1U / μl), 1 μL; nucleic acid template, 5 μL; nuclease-free water to make up to 25 μL.

[0081] (2) The reaction system of RNA fluorescence PCR

[0082] 5×RT-PCR Buffer (Mg 2+ plus), 5 μL; dNTPs (10 mM each, containing dUTP), 1 μL; self-quenching fluorescence primers (10 pmol / μl), 0.3 μL to 1 μL; downstream / upstream primers (10 pmol / μl), 0.3 μL to 1 μL; MMLV reverse Transcriptase (5U / μl), 0.5μL;...

Embodiment 3

[0096] Example 3 Comparison of background signals of different labeling methods

[0097] 1. Primer Design

[0098] For the human ACTB gene (NCBI accession number: NG_007992.1), the primers of Example 1 were used to design the corresponding self-quenching fluorescence primers and common primers.

[0099] First, according to the ACTB gene sequence, the corresponding upstream and downstream primers were designed using the Pick Primers of NCBI. In order to compare the quenching effect of "TG, GT, CG, GC" bases, the upstream primer sequences without "TG, GT, CG, GC" bases were selected as: CCCCTTCCCTCCTCAGATCAT, and then the corresponding primers were manually set at the 5' end of the primers. The linker sequence, the linker sequences are: "GCAATG", "GCAAGT", "GCAACG", "GCAAGC", "TG" base, "GT" base, "CG" base, "GC" base in the linker sequence The T or C bases are labeled with FAM fluorescent dyes. Primer sequences and labels are shown in Table 3. ACTBF1 and ACTBR are combinati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for self-quenching fluorescence as well as a design method and application of the primer. The sequence of the primer contains a 'TG' basic group, a 'GT' basic group, a 'CG' basic group or a 'GC' basic group, and a T basic group or a C basic group of the 'TG' basic group, the 'GT' basic group, the 'CG' basic group or the 'GC' basic group is marked with a fluorescent dye; the sequence of the primer does not contain a primer sequence of a'TG 'basic group, a'GT' basic group, a'CG 'basic group or a'GC' basic group; the 5'end of the primer is additionally provided with a linker sequence containing a TG basic group or a GT basic group, the T basic group of the TG basic group or the GT basic group in the linker sequence is marked with a fluorescent dye, or the 5 'end of the primer is additionally provided with a linker sequence containing a CG basic group or a GC basic group, and the C basic group of the CG basic group or the GC basic group in the linker sequence is marked with a fluorescent dye; the primer can be self-quenched; and the requirement of multiple detection can be met.

Description

technical field [0001] The invention relates to the technical field of fluorescent PCR, and more particularly, to a primer for self-quenching fluorescence and a design method and application thereof. Background technique [0002] Real-time fluorescent PCR detection technology has many advantages such as high sensitivity, strong specificity, simplicity, rapidity, and low cost. It is the most commonly used method for pathogenic microorganism detection. The current multiplex fluorescent PCR method is based on the above-mentioned fluorescent probe technology or fluorescent dye method for detection. The multiplex PCR technology based on the fluorescent probe method refers to the addition of multiple pairs of primers and the addition of specific probes with different fluorescent labels during multiplex PCR amplification, and the ends of the probes are labeled with different fluorescent groups and The quenching group relies on the 5'→3' exonuclease activity of DNA polymerase to di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806C12Q1/686C12Q1/6876C12N15/11
CPCC12Q1/6806C12Q1/686C12Q1/6876C12Q2600/16C12Q2563/107C12Q2525/191C12Q2525/117C12Q2537/143Y02A50/30
Inventor 周玲玲麻昕雨温清娜
Owner 广州博懿瑞生物科技有限公司