Fluorescence self-quenching primer as well as design method and application thereof
A design method and self-quenching technology, applied in the field of fluorescent PCR, can solve the problems of self-quenching primer background signal enhancement, inability to perform melting curve analysis, insufficient ability to detect mutations, etc., to improve sensitivity and accuracy, reduce design Difficulty, the effect of reducing synthesis cost and difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Example 1 Design of primers for self-quenching fluorescence
[0068] 1. Design method of primers for self-quenching fluorescence
[0069] (1) Design corresponding upstream primers and downstream primers according to the gene sequence of the substance to be tested;
[0070] (2) search for "TG" base or "GT" base or "CG" base or "GC" base in the sequence of upstream or downstream primer;
[0071] (3) Labeling a fluorescent dye on the T or C base in the "TG" base or the "GT" base or the "CG" base or the "GC" base.
[0072] 2. The specific method of primer design for self-quenching fluorescence
[0073] Select primers that have been designed for the gene of the substance to be tested, the primer sequence is 16-30 bases, look for the "TG" base or "GT" base or "CG" base in the upstream primer or downstream primer sequence, and then Label the corresponding fluorescent dye on the T base or C base to obtain a self-quenching fluorescence primer. The fluorescent dye is labeled ...
Embodiment 2
[0075] Embodiment 2 A kind of PCR detection method based on the primer of self-quenching fluorescence
[0076] 1. Extract nucleic acid from the sample
[0077] Extract and purify nucleic acid from the sample using a nucleic acid extraction kit.
[0078] 2. PCR system preparation
[0079] (1) Reaction system of DNA fluorescence PCR
[0080] 10×PCR Buffer (Mg 2+ plus), 2.5 μL; dNTPs (10 mM each, containing dUTP), 1 μL; self-quenching fluorescence primers (10 pmol / μl), 0.3 μL to 1 μL; downstream / upstream primers (10 pmol / μl), 0.3 μL to 1 μL; DNA Polymerase (5U / μl), 0.5 μL; UDG enzyme (1U / μl), 1 μL; nucleic acid template, 5 μL; nuclease-free water to make up to 25 μL.
[0081] (2) The reaction system of RNA fluorescence PCR
[0082] 5×RT-PCR Buffer (Mg 2+ plus), 5 μL; dNTPs (10 mM each, containing dUTP), 1 μL; self-quenching fluorescence primers (10 pmol / μl), 0.3 μL to 1 μL; downstream / upstream primers (10 pmol / μl), 0.3 μL to 1 μL; MMLV reverse Transcriptase (5U / μl), 0.5μL;...
Embodiment 3
[0096] Example 3 Comparison of background signals of different labeling methods
[0097] 1. Primer Design
[0098] For the human ACTB gene (NCBI accession number: NG_007992.1), the primers of Example 1 were used to design the corresponding self-quenching fluorescence primers and common primers.
[0099] First, according to the ACTB gene sequence, the corresponding upstream and downstream primers were designed using the Pick Primers of NCBI. In order to compare the quenching effect of "TG, GT, CG, GC" bases, the upstream primer sequences without "TG, GT, CG, GC" bases were selected as: CCCCTTCCCTCCTCAGATCAT, and then the corresponding primers were manually set at the 5' end of the primers. The linker sequence, the linker sequences are: "GCAATG", "GCAAGT", "GCAACG", "GCAAGC", "TG" base, "GT" base, "CG" base, "GC" base in the linker sequence The T or C bases are labeled with FAM fluorescent dyes. Primer sequences and labels are shown in Table 3. ACTBF1 and ACTBR are combinati...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


