Heteroprotein of melanoma EPI (Mage-1, HLA-Al) and bacteriophage coat protein and its application
An HLA-A1, melanoma technology, applied to the hybrid protein of melanoma epitope (Mage-1, HLA-A1) and phage coat protein and its application field, can solve the lack of tumor diagnosis, prevention and treatment, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0031] Embodiments of the invention include the following:
[0032] 1. Synthesis of epitope gene:
[0033] The epitope gene fragment (AAGCAGACCCCACCGGCCACTCCTATG) was synthesized using a DNA synthesizer from a commercial bio company.
[0034] 2. Construction of recombinant vector
[0035] The recombinant vector was constructed using the published plasmid pfd8sy [Gene, 171 (1996) 49-51] as the original plasmid.
[0036] 1) Take 5 μg of pfd8sy plasmid, add 1-2 μL of SacII enzyme, and then add buffer and sterile water to a total volume of 200 μl. Incubate at 37°C for 24 hours. After digestion, the plasmid DNA was extracted by conventional methods. After extraction, DNA was precipitated with ammonium acetate and two volumes of ethanol, and dissolved in 50 μL TE solution.
[0037] 2) Treat the plasmid DNA that has been digested by the first restriction endonuclease Sty I with the same method as above.
[0038] 3) After double digestion, perform agarose gel electrophoresis to ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com