Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Heteroprotein of melanoma EPI (Mage-1, HLA-Al) and bacteriophage coat protein and its application

An HLA-A1, melanoma technology, applied to the hybrid protein of melanoma epitope (Mage-1, HLA-A1) and phage coat protein and its application field, can solve the lack of tumor diagnosis, prevention and treatment, etc. question

Inactive Publication Date: 2005-12-21
NORTHEAST NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still a lack of drugs that cannot effectively diagnose, prevent and treat tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] Embodiments of the invention include the following:

[0032] 1. Synthesis of epitope gene:

[0033] The epitope gene fragment (AAGCAGACCCCACCGGCCACTCCTATG) was synthesized using a DNA synthesizer from a commercial bio company.

[0034] 2. Construction of recombinant vector

[0035] The recombinant vector was constructed using the published plasmid pfd8sy [Gene, 171 (1996) 49-51] as the original plasmid.

[0036] 1) Take 5 μg of pfd8sy plasmid, add 1-2 μL of SacII enzyme, and then add buffer and sterile water to a total volume of 200 μl. Incubate at 37°C for 24 hours. After digestion, the plasmid DNA was extracted by conventional methods. After extraction, DNA was precipitated with ammonium acetate and two volumes of ethanol, and dissolved in 50 μL TE solution.

[0037] 2) Treat the plasmid DNA that has been digested by the first restriction endonuclease Sty I with the same method as above.

[0038] 3) After double digestion, perform agarose gel electrophoresis to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of DNA recombination in bioengineering. The invention utilizes the DNA recombination technology to insert the melanoma epitope (Mage-1, HLA-A1) gene fragment into the vector integrated with the main coat protein gene of the filamentous phage to construct a new recombination vector. In the host bacteria, the epitope gene product is secreted out of the cell and assembled in the phage coat protein to form a hybrid protein. It can be used as an antigen to generate immune response with antibodies in the sera of various tumor patients. Cellular immunity and specific CTL responses were generated in the model mice, and in the immune protection and prevention experiments of tumor model mice, the tumor occurrence time was delayed and the survival rate was improved. The hybrid protein has good application in preparing medicines for diagnosing, preventing and treating tumors.

Description

technical field [0001] This patent belongs to biological products produced by DNA recombination technology in biological engineering and its application. Background technique [0002] Tumor is the world's second "killer" disease after cardiovascular disease. By the end of 1999, the total number of cancer patients in the world has exceeded 40 million. In my country, 1.3 million people die of cancer every year. At present, there is still a lack of drugs that cannot effectively diagnose, prevent and treat tumors. [0003] Melanoma epitope, Mage-1, HLA-A1, is a specific antigen that only exists on the surface of tumor cells but not on the surface of normal cells except testis. The epitope gene fragment is inserted into the vector integrated with the main coat protein gene of the filamentous bacteriophage to construct a new recombinant vector. This recombinant vector is transferred into the host bacteria, Escherichia coli, and in the presence of helper phage, the tumor epitop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K38/16A61P35/00C07K19/00C12N15/63G01N33/574G01N33/68G01N33/96
Inventor 王丽房金波
Owner NORTHEAST NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com