Novel vaccine of tumor antigen, its preparation method and vaccine composition
A tumor antigen and vaccine technology, which is applied in the fields of bioengineering and medicine, can solve problems such as weak combination of antigen and antibody, difficulty in preparing human antibody, and affecting antigen delivery effect, and achieves improved T cell activation effect, simple method, The effect of enhancing antigenicity
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2004-03-17
- Estimated Expiration
- Not applicable · inactive patent
Abstract
Description
technical field
[0001] The invention relates to the fields of bioengineering and medicine. More specifically, the present invention relates to a novel tumor antigen vaccine, its preparation method and vaccine composition. Background of the invention
[0002] Tumor is still one of the main causes of death of human beings. Although the level of diagnosis and treatment of tumors has been continuously improved and improved in recent years, and the regimens of chemotherapy and radiotherapy have also been continuously improved, but in the end most patients still cannot escape the bad luck of death. In recent years, advances in molecular biology and further understanding of the function of the immune system have led to a rapid development of research and development of biotherapeutic methods. The development of tumor vaccines is one of the most important directions of tumor biotherapy [1-3].
[0003] Although the humoral immune system may generate some anti-tumor immune response...
Examples
Embodiment 1
[0043] Example 1: MUC1 Tumor Antigen Vaccine
[0044] The full sequence of MUC1 can be retrieved from GenBank (NM...002456). Using the Invitrogene company's reverse transcription kit, according to the manufacturer's instructions, cDNA was synthesized from X-108 gastric cancer cell line (gastric cancer cell line derived from surgical specimens) by mRNA reverse transcription method to obtain MUC1 DNA.
[0045]Similarly, cDNA was reverse-transcribed from human B lymphocyte mRNA to obtain CH3 DNA using the Invitrogene company's reverse transcription kit according to the manufacturer's instructions. The DNA sequence of CH3 is shown as SEQ ID NO: 2 in the sequence listing.
[0046] MUC1 was synthesized by using the DNA of MUC1 obtained above as a template PCR method (5' PCR primer sequence AACCCGGTACCACAGGTTCTGGTCATGCAAGC (SEQ ID NO: 3), 3' PCR primer sequence AACCCCCTCGAGGGGGGCGGTGGAGCCCGGGGCC (SEQ ID NO: 4)). MUC1 was cloned into the multiple cloning site of pcDNA3.1 vector (pur...
Embodiment 2
[0051] Example 2: CEA Tumor Antigen Vaccine (CAP-1)
[0052] First, use the Invitrogene reverse transcription kit to operate according to the manufacturer's instructions, and synthesize cDNA from human B lymphocyte mRNA by reverse transcription to obtain the DNA of the Fc segment. The DNA sequence of the Fc segment is shown in SEQ ID NO: 7 in the sequence listing.
[0053] The DNA coding sequence of CAP-1 is known as TACCTTTCGGGAGCGAACCTCAACCTCTCC (SEQ ID NO: 8), and the DNA of the CAP-1-Fc recombinant protein was synthesized by PCR method using the above obtained Fc segment cDNA as a template (5'PCR primer sequence AACCCGGTACCATGTACCTTTCGGGAGCGAACCTCAACCTCTCCGCAGAGCCCAAATCTTGTGA (SEQ ID NO: 8) ID NO: 9), 3' PCR primer sequence AACCCTCTAGATTATCATTTACCCGGAGA (SEQ ID NO: 10)). CAP-1-Fc was cloned into the corresponding site in the pcDNA3.1 vector with restriction endonuclease Xho I / Xba I, so that CAP-1 and Fc were connected in series.
[0054] After pcDNA3.1 was amplified in D...
Embodiment 3
[0058] Example 3: P53 Tumor Antigen Vaccine
[0059] The full sequence of human P53 can be retrieved from GenBank (M14695). The plasmid containing the P53 gene can be purchased from ATCC, USA, and its complete amino acid sequence is shown in SEQ ID NO:11. Similarly, cDNA was reverse-transcribed from human B lymphocyte mRNA to obtain CH3 DNA using the Invitrogene company's reverse transcription kit according to the manufacturer's instructions.
[0060] Using the P53 DNA obtained above as a template, P53 was synthesized by PCR method (5' PCR primer sequence AACCCGGTACCATGGAGGAGCCGCAGTCAGAT (SEQ ID NO: 12), 3' PCR primer sequence AACCCCCTCGAGGTCTGAGTCAGGCCCTTC (SEQ ID NO: 13)). P53 was cloned into the multiple cloning site of pcDNA3.1 vector (purchased from Invitrogene) with restriction endonuclease Kpn I / Xho I. Similarly, the CH3 fragment of immunoglobulin Fc was synthesized by PCR using the CH3 DNA obtained above as a template (5' PCR primer sequence AACCCTCTCGAGGGCAGCCCCGAGA...