Novel vaccine of tumor antigen, its preparation method and vaccine composition

A tumor antigen and vaccine technology, which is applied in the fields of bioengineering and medicine, can solve problems such as weak combination of antigen and antibody, difficulty in preparing human antibody, and affecting antigen delivery effect, and achieves improved T cell activation effect, simple method, The effect of enhancing antigenicity

Inactive Publication Date: 2004-03-17
李进
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the way of antigen-antibody complex to activate DC also has its drawbacks. First, the preparation of antigen and antibody should be carried out separately, especially the preparation of human antibody is still quite difficult.
Second, the activation of DC also requires the participation of inflammat

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0043] Example 1: MUC1 tumor antigen vaccine

[0044] The full sequence of MUC1 can be retrieved from the gene bank (NM...002456). Using Invitrogene's reverse transcription kit and operating according to the manufacturer's instructions, cDNA was synthesized from X-108 gastric cancer cell line (gastric cancer cell line derived from surgical specimens) by mRNA reverse transcription method to obtain MUC1 DNA.

[0045]Similarly, the reverse transcription kit of Invitrogene was used in accordance with the manufacturer's instructions to synthesize cDNA from human B lymphocyte mRNA by reverse transcription to obtain CH3 DNA. The DNA sequence of CH3 is shown in SEQ ID NO: 2 in the sequence listing.

[0046] The DNA of MUC1 obtained above was used as a template to synthesize MUC1 by PCR method (5' PCR primer sequence AACCCGGTACCACAGGTTCTGGTCATGCAAGC (SEQ ID NO: 3), 3'PCR primer sequence AACCCTCGAGGGGGGGCGGTGGAGCCCGGGGCC (SEQ ID NO: 4)). The restriction enzyme Kpn I / Xho I was used to clone ...

Example Embodiment

[0051] Example 2: CEA tumor antigen vaccine (CAP-1)

[0052] First, use Invitrogene's reverse transcription kit according to the manufacturer's instructions to synthesize cDNA from human B lymphocyte mRNA by reverse transcription to obtain Fc segment DNA. The DNA sequence of the Fc segment is shown in SEQ ID NO: 7 in the sequence listing.

[0053] The DNA coding sequence of CAP-1 is known as TACCTTTCGGGAGCGAACCTCAACCTCTCC (SEQ ID NO: 8). Using the Fc fragment cDNA obtained above as a template, the DNA of the CAP-1-Fc recombinant protein was synthesized by PCR (5' PCR primer sequence AACCGGTACCATGTACCTTTCGGGAGCGAACCTCAACCTCTCCGCAGAGCCCAAATCTTGTGA (SEQ ID NO: 8) ID NO: 9), 3'PCR primer sequence AACCCTCTAGATTATCATTTACCCGGAGA (SEQ ID NO: 10)). The restriction enzymes Xho I / Xba I were used to clone CAP-1-Fc into the corresponding site in the pcDNA3.1 vector, so that CAP-1 and Fc were connected in series.

[0054] After pcDNA3.1 was amplified in DH-5α (purchased from Invitragene), plasm...

Example Embodiment

[0058] Example 3: P53 tumor antigen vaccine

[0059] The full sequence of human P53 can be retrieved from the gene bank (M14695). The plasmid containing the P53 gene can be purchased from ATCC in the United States, and the full amino acid sequence is shown in SEQ ID NO:11. Similarly, the reverse transcription kit of Invitrogene was used in accordance with the manufacturer's instructions to synthesize cDNA from human B lymphocyte mRNA by reverse transcription to obtain CH3 DNA.

[0060] P53 was synthesized by PCR using the P53 DNA obtained above as a template (5' PCR primer sequence AACCGGTACCATGGAGGAGCCGCAGTCAGAT (SEQ ID NO: 12), 3'PCR primer sequence AACCCTCGAGGTCTGAGTCAGGCCCTTC (SEQ ID NO: 13)). The restriction enzyme Kpn I / Xho I was used to clone P53 into the multiple cloning site in the pcDNA3.1 vector (purchased from Invitrogene). Similarly, the CH3 fragment of immunoglobulin Fc (5'PCR primer sequence AACCCCTCGAGGGCAGCCCCGAGAACCAC (SEQ ID NO: 5), 3'PCR primer sequence AACCCTC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The new tumor antigen vaccine includes sequence with seven or more amino acids from tumor antigen and CH3 part amino acid sequence of immune globulin, and the two sequences are connected mutually. The NDA sequence encoding the tumor antigen vaccine, its preparation process and the vaccine composition containing the tumor antigen vaccine are also disclosed. The vaccine of the present invention has molecular weight many times smaller than that of antigen-antibody composition, and is easy to be phagocytized by dendritic cell to produce powerful immunological effect.

Description

technical field [0001] The invention relates to the fields of bioengineering and medicine. More specifically, the present invention relates to a novel tumor antigen vaccine, its preparation method and vaccine composition. Background of the invention [0002] Tumor is still one of the main causes of death of human beings. Although the level of diagnosis and treatment of tumors has been continuously improved and improved in recent years, and the regimens of chemotherapy and radiotherapy have also been continuously improved, but in the end most patients still cannot escape the bad luck of death. In recent years, advances in molecular biology and further understanding of the function of the immune system have led to a rapid development of research and development of biotherapeutic methods. The development of tumor vaccines is one of the most important directions of tumor biotherapy [1-3]. [0003] Although the humoral immune system may generate some anti-tumor immune response...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/00C07K19/00
CPCC07K2319/00A61K39/0011C07K19/00A61K39/00A61P35/00
Inventor 李进
Owner 李进
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap