Novel vaccine of tumor antigen, its preparation method and vaccine composition
A tumor antigen and vaccine technology, which is applied in the fields of bioengineering and medicine, can solve problems such as weak combination of antigen and antibody, difficulty in preparing human antibody, and affecting antigen delivery effect, and achieves improved T cell activation effect, simple method, The effect of enhancing antigenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0043] Example 1: MUC1 Tumor Antigen Vaccine
[0044] The full sequence of MUC1 can be retrieved from GenBank (NM...002456). Using the Invitrogene company's reverse transcription kit, according to the manufacturer's instructions, cDNA was synthesized from X-108 gastric cancer cell line (gastric cancer cell line derived from surgical specimens) by mRNA reverse transcription method to obtain MUC1 DNA.
[0045]Similarly, cDNA was reverse-transcribed from human B lymphocyte mRNA to obtain CH3 DNA using the Invitrogene company's reverse transcription kit according to the manufacturer's instructions. The DNA sequence of CH3 is shown as SEQ ID NO: 2 in the sequence listing.
[0046] MUC1 was synthesized by using the DNA of MUC1 obtained above as a template PCR method (5' PCR primer sequence AACCCGGTACCACAGGTTCTGGTCATGCAAGC (SEQ ID NO: 3), 3' PCR primer sequence AACCCCCTCGAGGGGGGCGGTGGAGCCCGGGGCC (SEQ ID NO: 4)). MUC1 was cloned into the multiple cloning site of pcDNA3.1 vector (pur...
Embodiment 2
[0051] Example 2: CEA Tumor Antigen Vaccine (CAP-1)
[0052] First, use the Invitrogene reverse transcription kit to operate according to the manufacturer's instructions, and synthesize cDNA from human B lymphocyte mRNA by reverse transcription to obtain the DNA of the Fc segment. The DNA sequence of the Fc segment is shown in SEQ ID NO: 7 in the sequence listing.
[0053] The DNA coding sequence of CAP-1 is known as TACCTTTCGGGAGCGAACCTCAACCTCTCC (SEQ ID NO: 8), and the DNA of the CAP-1-Fc recombinant protein was synthesized by PCR method using the above obtained Fc segment cDNA as a template (5'PCR primer sequence AACCCGGTACCATGTACCTTTCGGGAGCGAACCTCAACCTCTCCGCAGAGCCCAAATCTTGTGA (SEQ ID NO: 8) ID NO: 9), 3' PCR primer sequence AACCCTCTAGATTATCATTTACCCGGAGA (SEQ ID NO: 10)). CAP-1-Fc was cloned into the corresponding site in the pcDNA3.1 vector with restriction endonuclease Xho I / Xba I, so that CAP-1 and Fc were connected in series.
[0054] After pcDNA3.1 was amplified in D...
Embodiment 3
[0058] Example 3: P53 Tumor Antigen Vaccine
[0059] The full sequence of human P53 can be retrieved from GenBank (M14695). The plasmid containing the P53 gene can be purchased from ATCC, USA, and its complete amino acid sequence is shown in SEQ ID NO:11. Similarly, cDNA was reverse-transcribed from human B lymphocyte mRNA to obtain CH3 DNA using the Invitrogene company's reverse transcription kit according to the manufacturer's instructions.
[0060] Using the P53 DNA obtained above as a template, P53 was synthesized by PCR method (5' PCR primer sequence AACCCGGTACCATGGAGGAGCCGCAGTCAGAT (SEQ ID NO: 12), 3' PCR primer sequence AACCCCCTCGAGGTCTGAGTCAGGCCCTTC (SEQ ID NO: 13)). P53 was cloned into the multiple cloning site of pcDNA3.1 vector (purchased from Invitrogene) with restriction endonuclease Kpn I / Xho I. Similarly, the CH3 fragment of immunoglobulin Fc was synthesized by PCR using the CH3 DNA obtained above as a template (5' PCR primer sequence AACCCTCTCGAGGGCAGCCCCGAGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More