Variable region gene in heavy chain and light chain of anti Pgp monoclone antibody
A variable region, antibody technology, applied in the direction of antibodies, anti-tumor drugs, recombinant DNA technology, etc., can solve problems such as limitations, and achieve the effect of wide application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1. Gene cloning of light and heavy chain variable regions of anti-Pgp antibody.
[0025] Take guanidinium isothiocyanate one-step method (Chomczynski P, Sacchi N, Single-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162: 156) to extract total RNA,
[0026] Amplify the light and heavy chain variable region genes of the anti-PGP monoclonal antibody PHMA02 by reverse transcription: take 2 μg of total RNA and put it in a 0.5ml Eppendorf tube, add 600ng of random primers, 10nmol each of 4×dNTP, 20μl of Rnasin, and store at 65°C Water bath for 5-10 minutes, then add 200 U of M-MLV reverse transcriptase, place in 37°C water bath for 1 hour, transfer to 70°C water bath for 10 minutes.
[0027] Light chain variable region gene PCR amplification reaction system (100μl): reverse transcription product 10μl, 10mM dNTP 2μl, 10×PCR buffer 10μl, Taq DNA polymerase 2U, light chain amplification of recombinant phage...
Embodiment 2
[0030] Example 2, Construction of Single-chain Antibody Gene Expression Vector PET28a(+)PGPscFv
[0031]Use primers ① and ② to amplify the Pgp scFv gene from the PCANTAB PGPscFv plasmid (amplified together with the purification marker E-tag), and add a HindIII restriction site at the 5' end, and then use the PET28a (+) plasmid (purchased from Novagen Co. ) is the template with primers ③ ④ amplified to the fragment between the start codon and the restriction site SphI of the vector. After the above two fragments are connected by OverlapPCR, the purified PCR product is treated with HindIII+SphI and then combined with HindIII +SphI-treated PET28c(+) carrier ligation (16°C, overnight).
[0032] Primer ① 5'GACCAGGTCAAACTGCAGCA 3'.
[0033] ② 5'GCGTACCTAAGCTTTGCGGCACGCGGTTCCAG 3'.
[0034] ③ 5'CGCAAGGAATGGTGCATGCA 3'.
[0035] ④ 5'TGCTGCAGTTTGACCTGGTCGCTGCTGCCCATGGTATATC 3'.
Embodiment 3
[0036] Example 3. Expression, purification and renaturation of anti-PgpScFv antibody fragments. 3.1 Expression of anti-PgpScFv antibody fragments:
[0037] Escherichia coli BL21 was transformed with the constructed PET28c(+)-PGPscFv plasmid, and transformants were screened on LB plates (1% agar) containing 50 ug / ml kanamycin. After picking and activating the correct monoclonal clone, shake culture at 37°C until OD600=0.7-0.9, add IPTG (Isopropylthiogalactopyranoside, purchased from SIGMA, the final concentration is 100umol / L), 37°C, 250rpM After induction of expression for 3 hours, the cells were collected by centrifugation at 6200g and 4°C for 15 minutes. Add 1 / 30 culture volume of ice-precooled 50mmol / Ltris-HCL, 100mmol / L NaCl, 1mmol / LEDTA, pH 7.0 to the collected bacterial pellet to dissolve. After repeated freezing and thawing three times, the cells were sonicated (sonication for 30 seconds / cooling for 1 minute / 200 watts / 8 times), and centrifuged at 30,000 g for 30 minut...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More