Check patentability & draft patents in minutes with Patsnap Eureka AI!

Gene chip internal reference, preparation method and application thereof

A gene chip hybridization and internal reference technology, applied in the field of gene chip detection of gene mutation or genotype, to achieve the effect of improving accuracy and sensitivity, reducing primer and template competition, and simple method

Inactive Publication Date: 2010-09-29
SHANGHAI INST OF MICROSYSTEM & INFORMATION TECH CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the mutant template prepared by the lengthening and truncation method has the advantages of intuitiveness and simplicity in the analysis of PCR products, since the mutant template is lengthened or shortened on the basis of the wild template sequence, and the length of the wild template is significantly different, The same amplification efficiency cannot be guaranteed, which will affect the accuracy of quantitative analysis of competitive PCR; the length of the internal reference and the target fragment prepared by the enzyme-cutting site method can guarantee the equivalent amplification of the two, but this method has two Disadvantages: First, it is difficult to select or increase a suitable restriction enzyme site, which is limited in practical application; second, if the complete digestion of the internal reference amplification product cannot be guaranteed, the analysis efficiency of the product will be reduced. Accuracy
For example, the detection of hepatitis C virus requires two amplifications, so the preparation of the internal reference is more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip internal reference, preparation method and application thereof
  • Gene chip internal reference, preparation method and application thereof
  • Gene chip internal reference, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1. Selection of the internal reference template of the gene chip

[0044] From E.coli chromosomal region from 89.2 to 92.8minutes, GeneBank accession number: U00006. A part of the gene sequence was cloned by our laboratory, the full length is about 500bp, and it was cloned into the T vector. Sequence analysis showed that one of the sequences was very similar in base composition to the amplified fragment of the HCV 5' non-coding region, and had no special secondary structure, so primers were designed based on this sequence.

[0045] GCGTTATTTGAGGAGAACGGCTGAGTGCGGTT

[0046] GCCAGACCGGCAGCGTATTACTCCAGGGCGTCGGCAAACTGACCTGCT

[0047] CTGTCCGGCTGTAGTGCGTTATCCAGCGCCTGCGCCGAGTTCCAGGTGGC

[0048] ATCCCAGG

Embodiment 2

[0049] Example 2. Design of primers and preparation of internal reference

[0050] 1. Synthesis of primers

[0051] Both sides of the above sequence are directly connected to the inner primer sequence (shaded part) of the nested PCR of the HCV 5' non-coding region. The primer synthesis is entrusted to Boya Bioengineering Co., Ltd.

[0052] taggcgggtgtctcttcaa

[0053] agggccgcgatcttcttcacg

[0054] The primers are used to amplify the above-mentioned gene plasmids, and the amplified products are purified.

[0055] Then synthesize the second pair of primers, which are combined by the inner and outer primers of HCV nested PCR, design the PCR program according to the primer conditions, use the above-mentioned purified PCR product as a template, and perform PCR amplification again.

[0056] The amplified product was purified again and ligated into a T vector to make a clone.

[0057] 2. Product purification and quantification

[0058] 1. Use Roche's Agarose Gel DNA Extract...

Embodiment 3

[0078] Example 3. Preparation and preliminary quantification of internal reference plasmids

[0079] Thaw the preserved strain, shake the bacteria, and then use Qiagen's Hispeed Plasmid Midi kit for plasmid extraction. The specific method is operated according to the Hispeed Plasmid Midi kit protocol. Finally, an ultraviolet spectrophotometer was used to measure the OD260 / 280 value of the plasmid solution. The OD value was equal to 1.83, and the purity had met the requirements; the concentration was measured, the plasmid was quantified, and the solution was diluted to 106 copies / ml and stored at -20°C for later use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A positive internal reference of the biochip for the typing test of HCV gene is prepared through choosing a fragment of gene sequence, without any homology to HCV-DNA, designing a pair of primers, and synthesizing by adding the same sequence as the external and internal nested primers to both ends of said primer. It can be used for the extraction, amplification and crossing of HVC and for qualitatively and quantitatively analyzing target gene.

Description

technical field [0001] The present invention relates to an internal reference, preparation method and application of a gene chip, more precisely to a positive internal reference, preparation and application of a hepatitis C virus genotyping detection chip. It belongs to the technical field of gene chip detection of gene mutation or genotype. Background technique [0002] Gene chip technology is a cutting-edge biotechnology emerging in the 1990s. Its basic principle is to immobilize a large number of oligonucleotide molecules on the support, and then hybridize with the labeled sample, and then judge the sample by detecting the strength of the hybridization signal. The number of on-target molecules. The concept of gene chips has been generalized to biochips, microarrays, DNA chips, and even protein chips. The gene chip integrates probe solid-phase in-situ synthesis technology, photolithography technology, polymer synthesis technology, precision control technology and laser ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 毛红菊刘康栋李宁赵建龙赵辉张宏莲张华
Owner SHANGHAI INST OF MICROSYSTEM & INFORMATION TECH CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More