Novel method for the production of polyunsaturated fatty acids
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
An unsaturated and desaturase technology, applied in the field of specific production of polyunsaturated omega-3 and omega-6 fatty acids, which can solve the problems of difficult and insufficient separation and characterization
Inactive Publication Date: 2006-02-01
UNIV OF BRISTOL
View PDF39 Cites 8 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, to date, the various desaturases have only been insufficiently characterized biochemically due to the great difficulty of isolating and characterizing the enzymes in the form of membrane-bound proteins (McKeon et al., Methods in Enzymol )71, 1981: 12141-12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777-792)
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0157] Example 1: General Cloning Method
[0158]Cloning methods such as restriction enzyme digestion, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and Nile membranes, ligation of DNA fragments, transformation of Escherichia coli, cultivation of bacteria, and preparation of recombinant DNA Sequence analysis was performed as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).
Embodiment 2
[0159] Example 2: Sequence Analysis of Recombinant DNA
[0160] Sequencing of the recombinant DNA molecules was carried out by the Sanger method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467) with a laser fluorescence DNA sequencer from the company ABI. The PCR-generated fragments were sequenced and checked to avoid polymerase errors in the construct to be expressed.
Embodiment 3
[0161] Example 3: Cloning of the delta-8-desaturase (=SEQ ID NO: 1 ) from Euglena pumilus
[0162] PCR amplification was performed using cDNA from Euglena minutis strain Z as template. cDNA synthesis was from total RNA extracted from cultures of E. gracilis strain Z. Unique primers for the start methionine and stop codon of Euglena delta-8-desaturase were synthesized as follows, including restriction sites.
[0163] Primer 1: EDELTA8BamF
[0164] ATGGATCCACCATGAAGTCAAAGCGCCAA
[0165] Primer 2: EDELTA8XhoR
[0166] ATCTCGAGTTATAGAGCCTTTCCCCGCGC
[0167] PCR protocol
[0168] Annealing temperature: 45°C for 1 minute
[0169] Denaturation temperature: 94°C for 1 minute
[0170] Extension temperature: 72°C for 2 minutes
[0171] Number of cycles: 30
[0172] The PCR product was separated on an agarose gel to obtain a 1270 bp fragment. The PCR fragment was cloned into pGEM-T easy vector (Promega) and the insert was sequenced. This revealed the presence of an open readin...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The present invention relates to an improved process for the specific production of poly-unsaturated omega-3 and omega-6 fatty acids and a process for the production of triglycerides having an increased content of unsaturated fatty acids, in particular omega-3 and omega-6 fatty acids having at least two double bonds and a 20 or 22 carbon atom chain length. The invention relates to the produc-tion of a transgenic organism, preferably a transgenic plant or a transgenic microorganism, hav-ing an increased content of fatty acids, oils or lipids containing C20- or C22- fatty acids with a delta-5, 7, 8, 10 double bond, respectively due to the expression of a delta-8-desaturase and a delta-9- elon-gase from organisms such as plants preferably Algae like Isochrysis galbana or Euglena gracilis. In addition the invention relates to a process for the production of poly unsaturated fatty acids such as Eicosapentaenoic, Arachidonic, Docosapentaenoic or Docosahexaenoic acid through the co- expression of a delta -8-desaturase, a delta-9-elongase and a delta-5 desaturase in organisms such as microorganisms or plants.The invention additionally relates to the use of specific nucleic acid sequences encoding for the aforementioned proteins with delta-8-desaturase-, delta-9-elongase- or delta-5-desaturase-activity, nucleic acid constructs, vectors and organisms containing said nucleic acid sequences. The invention further relates to unsaturated fatty acids and triglycerides having an increased content of at least 1 % by weight of unsaturated fatty acids and use thereof.
Description
field of invention [0001] The present invention relates to an improved process for the specific production of polyunsaturated omega-3 and omega-6 fatty acids; and a process for the production of triglycerides with an increased content of unsaturated fatty acids, wherein said unsaturated fatty acids, inter alia, have at least two double bonds and 20 Or omega-3 and omega-6 fatty acids with a chain length of 22 carbon atoms. The present invention relates to the production of transgenic organisms, preferably transgenic plants or transgenic microorganisms, comprising C with Δ-5, 7, 8, 10 double bonds, respectively 20 - or C 22 - Increased content of fatty acids, oils or lipids, including fatty acids, which can be attributed to the expression of Δ8-desaturases and Δ9-elongases from organisms such as plants, preferably algae such as Isochrysis green light or Euglena minutis. In addition, the present invention also relates to the production of eicosapentaenoic acid, peanut Methods...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more