Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof

An angiogenesis and multipurpose technology, applied in the field of bioengineering, can solve the problems of increased difficulty in drug quality control, high dosage, and limited effect, and achieve the effects of specifically inhibiting endothelial cell proliferation, reducing side effects, and improving efficacy

Active Publication Date: 2006-09-06
NANJING ANJI BIOLOGICAL TECH CO LTD
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among these angiogenesis inhibitors, angiostatin and endostatin are the most eye-catching, both of which have entered clinical trials in the United States, although these vascular inhibitors present very attractive prospects , but its defects are also very obvious: so far, the targets of angiogenesis drugs, such as endostatin and angiostatin, are not clear, and their specificity and selectivity to blood vessels are not good enough, and the effect is limited, which leads to The dosage is very high. In the mouse animal mod

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof
  • Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof
  • Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Cloning of EDSM-1 gene and EDSM-2 and construction of prokaryotic expression vector:

[0037] The endostatin gene was taken as a template; an upstream primer and a downstream primer were synthesized, wherein the upstream primer added an NdeI restriction site; the downstream primer contained an Arg-Gly-Asp sequence and an XhoI site. PCR amplification was carried out, the amplified product was recovered and purified by agarose gel electrophoresis, digested with NdeI and XhoI, and cloned into the prokaryotic expression vector PET-23a, positive clones were screened by PCR, and the nucleotide sequence analysis confirmed that the sequence was designed mutation.

[0038] Synthetic primer 1: 5'GGAATTCCATATGTTC CAG CCG GTG CTC CAC CTG GTT 3'Synthetic primer 2:

[0039] 5' CCGCTCGAG ATCACCTCG CACCACCACCACCGGCGCGGAAGGTGCCCGCCAG3'

[0040] Synthetic Primer 3:

[0041] 5'CCGCTCGAGGCAGAAGCAGTCACCACGGCAGTCGCATGCACCACCACCACCGGCGCGGAAGGTGCCCGCCAG3'

[0042] Among them, primer 1 enco...

Embodiment 2

[0049] Anti-lung cancer experiment in animals

[0050] The cultured mouse Lewis lung cancer cells were digested with 0.05% trypsin, centrifuged at 1000rpm for 5min, resuspended in PBS, and subcutaneously inoculated 5×10 5 Cells 0.1ml. When the average tumor volume reaches 200mm 3 -300mm 3 , the mice were randomly divided into groups, 7 in each group, one group was treated with EDSM-1, and the other group was treated with endostatin. Treatment is by subcutaneous injection on the contralateral side of tumor inoculation. Measure the tumor size with a vernier caliper every day, and calculate the tumor volume, using the formula: tumor volume = length × width 2 ×0.52, the therapeutic effect is represented by the tumor inhibition rate within a given time: (1-T / C)×100%, T=tumor volume of the treatment group, C=tumor volume of the control group.

[0051] The results showed that on the 9th day, the tumor inhibition rate of EDSM-1 was 79%, while that of endostatin was 53% (P<0.05 fo...

Embodiment 3

[0054] Tumor inhibitory effect of HAC liver cancer model in mice

[0055] The cultured mouse HAC liver cancer cell line was digested with 0.05% trypsin, centrifuged at 1000rpm for 5min, resuspended in PBS, and subcutaneously inoculated 5×10 5 Cells 0.1ml. When the average tumor volume reaches 200mm 3 -300mm 3 , the mice were randomly divided into groups, 7 in each group, and treated by subcutaneous injection on the opposite side of the tumor inoculation. Measure the tumor size with a vernier caliper every day, and calculate the tumor volume, using the formula: tumor volume = length × width 2 ×0.52, the therapeutic effect is represented by the tumor inhibition rate within a given time: (1-T / C)×100%, T=tumor volume of the treatment group, C=tumor volume of the control group.

[0056] Divided into negative control group (distilled water), positive control group (endostatin) and EDSM-1, EDSM-2 treatment groups for research, subcutaneous injection administration, the results sh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of biological engineering, more specifically to a group of polypeptides for the highly effective inhibition for blood vessel formation, its preparing process and use as anti-tumor medicament. By modification to No.6-49 amino acids of the esoderma chalone, the obtained polypeptides have stronger in vivo antineoplastic activity and tumor targeting property than esoderma chalone.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a class of high-efficiency angiogenesis-inhibiting polypeptides, a preparation method thereof, and an application for antitumor drugs. Background technique [0002] Tumor angiogenesis inhibitors are a class of drugs that have attracted attention in the treatment of tumors in recent years. Some progress has been made in this area of ​​research, and they are expected to become a new class of promising drugs for tumor treatment in the future. The concept of tumor neovascularization was proposed by Algureza in 1947, who pointed out that an important feature of growing tumors is the ability to initiate the formation of new capillary endothelial cells from the host. In 1971, Folkman put forward the hypothesis that tumor growth and metastasis depend on angiogenesis, and that solid tumors can secrete tumor angiogenesis factors in the early stage to stimulate host capillary proliferation. N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/00C12P21/02C12N15/09A61K38/16A61P35/00A61P1/16
Inventor 徐寒梅沈子龙文良柱
Owner NANJING ANJI BIOLOGICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap