Preparation of N-aceto-D-neuraminic acid by N-aceto-D-neuraminic acid aldonase immobilizing method
A technology of neuraminic acid aldolase and neuraminic acid, which is used in immobilized enzymes, biochemical equipment and methods, enzymes, etc., can solve problems such as unfavorable separation of products, enzymes without immobilized enzymes, and long reaction times. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0044] 4. Preparation of Neu5Ac
[0045] After the N-acetyl-D-neuraminic acid aldolase immobilized enzyme is prepared as above, it can be contacted with the substrate N-acetylmannosamine and pyruvate or its salt, under conditions suitable for the catalytic activity of the enzyme Neu5Ac was prepared as follows.
[0046] Usually the reaction is carried out at a temperature of 20-30°C, preferably, the temperature is 22-30°C. In a preferred embodiment, the temperature is 28°C. The speed is usually 120-180 rpm.
[0047] Water is generally used to prepare solutions of pyruvate or its salts and N-acetylmannosamine. Of course, other solvents can also be used for formulation. Useful solvents are well known to those skilled in the art.
[0048] In addition, the method for measuring enzyme activity of the present invention is also well known in the art. For example, the methods for measuring enzyme activity used in the present invention include:
[0049] (1) Dilute a certain amoun...
Embodiment 1
[0063] Example 1: Acquisition of N-acetylneuraminic acid aldolase (E.C.4.1.3.3) gene derived from total DNA of E.coli TG1 and construction of recombinant plasmid pNA1
[0064] Use the following primers
[0065] 1:5' gacgctaccatggcaacgaatttacgt 3'
[0066] 2: 5'gatccagtcgactcgcccgcgctcttg 3'Using the total DNA of E.coli TG1 as a template, carry out PCR amplification. After PCR, acidify the recovered 0.9kb fragment, clone it into the pUC 118 plasmid digested by Hinc II, and name it pNA, transformed into E.coli DH5α competent cells. Recombinants were selected by X-ga1 blue and white spots, and positive recombinants were identified by enzyme digestion.
[0067] with the following primers
[0068] 1:5'ggaattccatatggcaacgaatttacgtggcg 3'
[0069] 2: 5'cgggatcctcacccgcgctcttgcatc 3' is used as a primer, and the plasmid pNA is used as a template to carry out PCR amplification. After PCR, the recovered 0.9kb fragment is digested with Nde I and BamH I and cloned into the pET28b(+) v...
Embodiment 2
[0070] Example 2: Fermentation of engineering bacteria BL21(DE3) / pNA1 and preparation of N-acetylneuraminic acid aldolase affinity carrier (Agar) immobilized enzyme
[0071] Use 3L TB culture medium (to prepare broth for every increase in concentration, add in 900ml deionized water: 12g of peptone for bacterial culture; 24g of yeast extract for bacterial culture; 4ml of glycerol. Autoclave for 20 minutes, then cool the solution to 60°C or below, then add 100ml of sterilized 0.17mol / LKH 2 PO 4 , 0.72mol / L K 2 HPO 4 Solution) Ferment engineering bacteria BL21(DE3) / pNA1 in a 5L fermenter. After culturing at 37°C for about 1h, add lactose with a final concentration of 1% to induce, and at the same time lower the temperature to 22°C, and add a final concentration of 0.5 % lactose induction, fermented for about 20 hours, closed the tank, centrifuged at 8000rpm for 10 minutes to collect the bacteria.
[0072] Weigh 10g of BL21(DE3) / pNA1 fermented for 20h, add 20ml of 0.5M pH7.5 s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
