Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Design and fermented production of recombinant peptide for reducing blood pressure

A technology of antihypertensive peptide and fermentation method, which is applied in the direction of fermentation, recombinant DNA technology, peptide, etc., and can solve the problems of high production cost and difficult implementation

Inactive Publication Date: 2006-12-27
BEIJING UNIV OF CHEM TECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using food as raw material to produce this small peptide by degrading protein, the production cost is high and it is difficult to implement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Design and fermented production of recombinant peptide for reducing blood pressure
  • Design and fermented production of recombinant peptide for reducing blood pressure
  • Design and fermented production of recombinant peptide for reducing blood pressure

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] 1. Gene design and synthesis: According to animal experiments or human food effects, small peptides that do have antihypertensive effects and are derived from human food are collected to form a small peptide library (specific peptide library). Select one or more of them to form a fusion protein, and convert the amino acid sequence of the fusion protein into the nucleotide sequence of the coding gene according to the Escherichia coli preference code. The gene was fully synthesized by chemical synthesis.

[0016] GAATCCCGCGGCCACAAAATCGCGACCTTTCAGGAACGCCTGTATCCGG

[0017] TGCGCGCGGTGAACCCGATTCGCGCGGTGCCGTATCCGCAGCGCCTGC

[0018] GCCCGTAAAAGCTT

[0019] 2. Construct the expression vector and obtain the engineering bacteria: select the commercialized plasmid pET-28a(+) of Novagen Company as the carrier, carry out double enzyme digestion (Eco R I+Hind III) of the target gene and the carrier DNA, and then connect them with T4DNA ligase , The product of the ligation reaction...

Embodiment 2

[0026] The small peptide produced by fermentation of the present invention is used in the antihypertensive test, and the result is the same as the antihypertensive peptide obtained from natural sources.

[0027] The test method for antihypertensive peptides to inhibit ACE I activity is quoted from: "Functional Fermented Products" edited by You Xin, p: 220-221, China Light Industry Press, 2000.1, first edition.

[0028] Preface

[0029] Preface

[0030] Note: IC 50 (μmol / L) refers to the concentration of antihypertensive peptide required when ACE I activity is inhibited to half. The smaller the value, the stronger the pressure reducing effect.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing recombinative reducing peptide, which uses DNA recombinant technology and prepares by gene engineering bacteria invoice method, and especially to the related gene design and synthesis of recombinative reducing peptide, construction of recombinative reducing peptide expression carrier, host conversion with the said expression carrier and construction of the gene engineering bacteria, and fermentation production of recombinative reducing peptide by the said gene engineering bacteria. First an anterior peptide should be designed, in which the peptide can be materials with repetition of one reducing peptide or mixed materials of several reducing peptides. For example, this invention adopts mixed peptides including LRP, LYPVK, AVNPIR, GHKIATFQER and AVPYPQR. Then the representation system pET-28a (+) of bacillus coli BL21 (DE3) is adopted and the amino acid sequence of the anterior peptide is transformed into single stage DNA sequence. Subsequently, the code genes of fused protein comprising this five reducing peptides are designed, the genes are synthesized with chemical method and are connected on the expression carrier, and the suitable positive clone is selected by conversion and determination with optimization fermentation technological condition and technological condition of segregation and decontamination for products, and the obtained recombinative reducing peptide has bioactivity similar to natural materials.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the fermentation production of antihypertensive peptide and the produced recombinant antihypertensive peptide. Background technique [0002] In 1965, Ferreira first discovered the antihypertensive peptide from the venom of the American mothhead viper (Bothrops jararaca). This functional small peptide was found by sake lees and others. However, the production of this small peptide by degrading protein from food as raw material is difficult to implement due to high production costs. [0003] In order to solve the above technical problems, the present invention provides a new method for producing antihypertensive peptide and the antihypertensive peptide produced thereby, that is, the recombinant antihypertensive peptide is produced by fermentation with genetically engineered bacteria. The recombinant antihypertensive peptide refers to a small peptide developed and produced by genetic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N15/63C12P21/02C12N15/11C12N15/70C07K5/08C07K7/06C12N15/62
Inventor 陈劲春李冬冬张佳秦伟涛
Owner BEIJING UNIV OF CHEM TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com