Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantitative PCR detecting method for hepatitis B virus and special reagent kit

A hepatitis B virus, fluorescence quantitative technology, applied in the direction of biological testing, fluorescence/phosphorescence, microbial measurement/inspection, etc., can solve the problems of not being suitable for clinical application, low specificity, etc., to shorten the extraction time and improve detection Sensitivity, simple and fast operation

Active Publication Date: 2007-04-11
SHANDONG MEDICAL BIO TECH RES CENT
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is not specific and not suitable for clinical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR detecting method for hepatitis B virus and special reagent kit
  • Fluorescent quantitative PCR detecting method for hepatitis B virus and special reagent kit
  • Fluorescent quantitative PCR detecting method for hepatitis B virus and special reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1. Design and synthesis of hepatitis B virus fluorescent quantitative PCR primers and probes

[0038] (1) Sequence comparison: use the sequence comparison function provided by http: / / www.ncbi.nlm.nih.gov / blast website to perform HBV whole gene sequence comparison, and find out the conserved regions in the whole genome.

[0039] (2) Using Beacon Designer 2.1 (Molecular Beacon Design Software 2.1) software to design fluorescent quantitative PCR primers and probes, the designed three pairs of primers and probes are respectively located in the conserved regions of surface antigen S, core antigen C and E antigens , primers and probe sequences were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0040] S region upstream and downstream primers and probes:

[0041] RSU: 5'AGAATCCTCACAATACCGCAGAGT 3'

[0042] RSL: 5'CACACGGTAGTTCCCCCTAGAA 3'

[0043] PS: 5'FAM-AGACTCGTGGTGGACTTCTCTCAAT-TAMARA 3'

[0044] C region upstream and downstrea...

Embodiment 2

[0052] Embodiment 2. The preparation of detection standard

[0053] (1) Extraction of viral DNA

[0054] Add 50 μl of 0.4M NaOH to 50 μl of serum from patients with hepatitis B virus, and incubate at 80° C. for 10 minutes. Centrifuge at 15,000 rpm for 30 seconds, take the supernatant, and add 25 μl of 0.4M Tris-HCl pH7.5.

[0055] (2) PCR amplification

[0056] PCR amplification was carried out with the same upstream and downstream primers as the surface antigen S, core antigen C and E antigens in fluorescent quantitative PCR.

[0057] The PCR amplification system is 25 μl, including

[0058] 10×PCR buffer 2.5μl

[0059] 2.5mM dNTP 2.0μl

[0060] Upstream primer (5μM) 1.0μl

[0061] Downstream primer (5μM) 1.0μl

[0062] Taq enzyme (5u / μl) 0.2μl

[0063] Viral DNA 2.0μl

[0064] h 2 O 16.3 μl

[0065] 25μl

[0066] 10×PCR buffer composition is 500mM / L Tris-HCl pH8.3, 500mM / LKCI, 20mM MgCI 2 . Amplification was carried out using...

Embodiment 3

[0071] Embodiment 3. Preparation of standard curve and its optimization

[0072] According to the copy number obtained after quantification, the samples of the three regions were made into 1×10 3 -10 7 (copies / μl) and other 5 gradiently diluted detection standards, respectively make three standard curves for three regions, and detect the Ct value of the same virus sample on three different standard curves (Ct is the cycle threshold, referring to each The number of cycles experienced when the fluorescent signal in the reaction tube reaches the set threshold value) and the copy number, so as to determine the standard curve with the best amplification effect. Among them, each sample has three repetitions. In order to reduce the sampling error and improve the repeatability of the experiment, a Thermo Electron (Saimo Company) electric sampling gun is used to add samples, and each experimental well is repeated three times.

[0073] (1) Extraction of viral DNA

[0074] Same as in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is fluorescent quantitative HBV PCR detecting method and special reagent kit, and belongs to the field of biotechnology. The method includes comparing three pairs of primer and probe of HBV surface antigen, kernel antigen and E antigen region to screen out one pair of primer and probe with best proliferation effect; comparing the variation in HBV copy number during fluorescent quantitative PCR proliferation of the serum DNA samples extracted in different methods to optimize the HBV extracting method, and performing quantitative PCR detection in optimized primer and probe and in simple virus DNA extracting method. The present invention has high sensitivity, high specificity, low cost, short time, accurate detection and other advantages. The present invention may be used clinically and in scientific research.

Description

technical field [0001] The invention specifically relates to a fluorescent quantitative PCR detection method for rapidly quantitatively detecting serum DNA of hepatitis B virus and a kit thereof, belonging to the field of biotechnology. Background technique [0002] HBV infection is the main cause of acute and chronic liver diseases. About 30% of the world's population, or 2 billion people, have ever been infected with hepatitis B virus, about 350 million chronic HBV infected people are facing the risk of developing fatal liver disease, and about 1 million chronic hepatitis B infected people die of liver cirrhosis every year and liver cancer. Among the known human carcinogens, hepatitis B virus is second only to tobacco. However, my country is a large hepatitis country, about 50%-70% of the population has been infected with hepatitis B virus, and 8%-12% of the population is HBsAg carriers. [0003] Given the high morbidity and mortality of chronic HBV and the long duratio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/70G01N21/64G01N33/96
Inventor 鲁艳芹韩金祥王传玺戚鹏沈忠林
Owner SHANDONG MEDICAL BIO TECH RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com