Double stranded linear nucleic acid probe and uses thereof

a nucleic acid probe and linear technology, applied in the field of nucleic acid amplification and detection, can solve the problems of unsatisfactory reaction kinetics of probes, prone to rapid mutation of viral rna targets in the bodies of hosts, and unsatisfactory for the detection of viral nucleic acids

Inactive Publication Date: 2005-10-13
ABBOTT LAB INC
View PDF11 Cites 59 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0018] The present invention also provides a method of detecting and/or quantifying a nucleic acid of interest in a test sample in which the sample is contacted with DNA amplification reagents to amplify a portion of the nucleic acid of interest, and a first oligonucleic acid probe that has a fluorophore and a quencher, and is specific for ...

Problems solved by technology

However, when the probe binds to its target, the probe-target hybrid forces the two ends of the probe apart, disrupting the interaction between the two terminal moieties, and thus restoring the fluorescent signal from the fluorophore.
Also, these probes do not have optimal reaction kinetics especially when low quantities of target nucleic acid are present.
The detection of viral RNAs presents certain challenges, which are not presented by the desire to detect DNAs of interest.
First, some viral RNA targets are prone to rapid mutation in the bodies of their hosts.
Many of the probes of the prior art are sensitive to single-nucleotide changes, and therefore, are not optimal for the detection of viral nucleic acids.
Unfortunately, it has been discovered by the present inventors that some prior art nucleic acid probes can interfere with the reverse transcription (i.e., enzymatic copying of RNA sequences into DNA sequences).
Some nucleic acids probes of the prior art are not well suited to detecting small quantity of nucleic acids of interest.
Other nucleic acids probes of the prior art are not well suited to the sensitive detection of large quantities of nucleic acids.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double stranded linear nucleic acid probe and uses thereof
  • Double stranded linear nucleic acid probe and uses thereof
  • Double stranded linear nucleic acid probe and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Effect of the Length Difference Between the Two Oligonucleic Acids of a Nucleic Acid Probe on Mismatch Tolerance Evaluated by Melting Curve Assays

[0056] Melting reactions were performed in a Stratagene Mx4000 multiplex quantitative PCR system with the following cycle conditions: 1 cycle of denaturation at 95° C. for 3 min; 75 cycles of 1-minute holding at a range of temperatures from 85° C. to 10° C. with an 1° C. decrement per cycle. Fluorescein (FAM) fluorescence measurements were recorded during each 1-minute hold of the 75 cycles. At the end of each run, the data were analyzed and melting curves were generated.

[0057] Table 2 sets forth the sequences of PCR primers and linear probes used in this and the following examples.

TABLE 2NameSequencePCR PrimersFP-295′ - ATTCCCTACAATCCCCAAAGTCAAGGAGT - 3′(SEQ ID NO:1)RP-255′ - CCCCTGCACTGTACCCCCCAATCCC - 3′(SEQ ID NO:2)RP-245′ - CCCCTGCACTGTACCCCCCAATCC - 3′(SEQ ID NO:3)Linear Probes1 labeled with FAM520-206-FAM- (5′) - ACAGCAGTACAAATG...

example 2

Effect of the Length Difference Between the Two Oligonucleic Acids of a Nucleic Acid Probe on Mismatch Tolerance Evaluated by Quantitative Real-Time RT-PCR Assays

[0060] This example shows the evaluations on three different probe sets 520-20 / que-16, 520-20 / que-12 and 520-31 / que-14 for their mismatch tolerances by performing the quantitative real-time RT (reverse transcription)-PCR assays. Five transcripts carrying different mutations were employed to test these three probe sets. In these non-competitive quantitative assays, each 100 μl RT-PCR reaction contained 1.25×RT-PCR buffer (62.5 mM Bicine, pH 8.05-8.25, 143.75 mM potassium acetate, 10% glycerol, 0.125 mM EDTA, 0.0125 mg / ml acetyl bovine serum albumin (BSA), 0.078% (v / v) Tween 20, and 0.025% (w / v) sodium azide), 2.5 mM MnCl2, 0.375 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP), 13.13 units of rTth DNA polymerase (Applied Biosystems), 0.6 μM HIV forward PCR primer FP-29, 1.6 μM HIV reverse PCR primer RP-25 (T...

example 3

Inhibition of RT-PCR by a Quenching Oligonucleotide with a Tm Higher than the RT Temperature

[0063] To examine the impact of utilizing a quencher probe with a Tm that is above the incubation temperature of the RT reaction, performance of the probe combination, lin-41 and que-23 (Table 2), was evaluated in a quantitative real-time reverse transcription (RT)-PCR assay. The quenching oligo, que-23, has a Tm of 60.27, above the 59° C. RT incubation temperature. In this competitive quantitative assay, each 100 μl RT-PCR reaction was carried out in the presence of 1×EZ buffer (containing 50 mM Bicine, pH 8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM Mn(OAc)2, 0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA polymerase (all from Applied Biosystems), 0.2 μM HIV forward PCR primer FP-29, 1.0 μM HIV reverse PCR primer RP-24, 0.1 μM FAM-labeled oligo probe lin-41 for detection of the HIV wild type PCR products, 0.2 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Ratioaaaaaaaaaa
Fluorescenceaaaaaaaaaa
Login to View More

Abstract

A double-stranded nucleic acid hybridization probe and methods of using the same are described. The probe described is particularly suited for real-time RT-PCR reactions and has high tolerance to mismatches.

Description

[0001] This application claims priority to the provisional application Ser. No. 60 / 526,480 filed on Dec. 3, 2003.FIELD OF INVENTION [0002] The invention relates generally to the field of nucleic acid amplification and detection. Additionally, the invention relates to compositions and methods for performing PCR and probe hybridization using a single reagent mixture. BACKGROUND [0003] DNA-based analyses are used routinely in a wide spectrum of settings, including clinical hematology, molecular genetics, microbiology and immunology. Many current techniques rely on PCR amplification of a polynucleotide of interest (hereinafter “target molecule”) in conjunction with several types of post-amplification detection techniques. Other non-PCR based amplification techniques are well known in the art including, but not limited to, oligo ligation assay (OLA), ligase chain reaction (LCR), transcription-mediated amplification (TMA), and strand displacement amplification (SDA). Additionally, these t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07H21/04
CPCC12Q1/6818C12Q1/6832C12Q1/6851C12Q2561/113C12Q2537/137C12Q2525/107C12Q2565/101C12Q2565/525
InventorABRAVAYA, KLARAHACKETT, JOHNHUANG, SHIHAILUK, KA-CHEUNGSALITURO, JOHNMORRISON, LARRY
OwnerABBOTT LAB INC