Breast Specific Genes and Proteins
a gene and gene technology, applied in the field of newly identified polynucleotides and polypeptides, can solve the problems of poor treatment and many breast masses discovered
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Determination of Transcription of a Breast Specific Gene
[0169] To assess the presence or absence of active transcription of a breast specific gene RNA, approximately 6 ml of venous blood is obtained with a standard venipuncture technique using heparinized tubes. Whole blood is mixed with an equal volume of phosphate buffered saline, which is then layered over 8 ml of Ficoll (Pharmacia, Uppsala, Sweden) in a 15-ml polystyrene tube. The gradient is centrifuged at 1800×g for 20 min at 5 C. The lymphocyte and granulocyte layer (approximately 5 ml) is carefully aspirated and rediluted up to 50 ml with phosphate-buffered saline in a 50-ml tube, which is centrifuged again at 1800×g for 20 min. at 5 C. The supernatant is discarded and the pellet containing nucleated cells is used for RNA extraction using the RNazole B method as described by the manufacturer (Tel-Test Inc., Friendswood, Tex.).
[0170] To determine the quantity of mRNA, a probe is designed with an identity to at least a porti...
example 2
Bacterial Expression and Purification of the BSG Proteins and Use for Preparing a Monoclonal Antibody
[0173] The DNA sequence encoding a polypeptide of the present invention, for this example BSG1, ATCC # 97175, is initially amplified using PCR oligonucleotide primers corresponding to the 5′ sequences of the protein and the vector sequences 3′ to the protein. Additional nucleotides corresponding to the DNA sequence are added to the 5′ and 3′ sequences respectively. The 5′ oligonucleotide primer has the sequence 5′ GCCACCATGGATGTTTTCAAG 3′ (SEQ ID NO:25) and contains an NcoI restriction enzyme site followed by 15 nucleotides of coding sequence starting from the initial amino acid of the processed protein. The 3′ sequence 5′ GCGCAGATCTGTCTCCCCCACTCTGGGC 3′ (SEQ ID NO:26) and contains a complementary sequence to a BgII restriction enzyme site and is followed by 18 nucleotides of the nucleic acid sequence encoding the protein. The restriction enzyme sites correspond to the restriction e...
example 3
Preparation of cDNA Libraries from Breast Tissue
[0176] Total cellular RNA is prepared from tissues by the guanidinium-phenol method as previously described (P. Chomczynski and N. Sacchi, Anal. Biochem., 162: 156-159 (1987)) using RNAzol (Cinna-Biotecx). An additional ethanol precipitation of the RNA is included. Poly A mRNA is isolated from the total RNA using oligo dT-coated latex beads (Qiagen). Two rounds of poly A selection are performed to ensure better separation from non-polyadenylated material when sufficient quantities of total RNA are available.
[0177] The mRNA selected on the oligo dT is used for the synthesis of cDNA by a modification of the method of Gobbler and Hoffman (Gobbler, U. and B. J. Hoffman, 1983, Gene, 25:263). The first strand synthesis is performed using either Moloney murine sarcoma virus reverse transcriptase (Stratagene) or Superscript II (RNase H minus Moloney murine reverse transcriptase, Gibco-BRL). First strand synthesis is primed using a primer / lin...
PUM
| Property | Measurement | Unit |
|---|---|---|
| body weight | aaaaa | aaaaa |
| volume | aaaaa | aaaaa |
| pH | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More