Milk and milk products for preventing or treating heart disease
a technology for heart disease and milk products, applied in the field of milk and milk products for preventing or treating heart disease, can solve the problems of increased intake of milk, increased risk of coronary heart disease, and increased consumption of milk. the effect of intak
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
ACRS Method
[0131] At least 10 hairs were pulled from the end of the tail switch of a cow so that the hook-shaped follicles were retained on the end of the removed hairs. This was achieved easily by pulling the tail hairs upward while holding the rest of the switch down. If the tail has been docked, longer hairs from the end of the docked tail or other locations on the body may be substituted. Tail hairs are preferred.
[0132] Five hair follicles from one cow were cut into a sterile 1.5 ml microfuge tube. Solution A (200 μl) was added to the tube and the tube placed in a boiling water bath for 1 5 minutes. The tube was removed and Solution B (200 μl) added followed by mixing. [0133] Solution A (200 mM NaOH) [0134] Solution B (100 mM Tris-HCl, pH 8.5 with an extra 200 mM HCl)—prepared by combining 1 M Tris-HCl, pH 8.5 (10 ml) with conc. HCl (1.67 ml) and making up to 100 ml with distilled water.
[0135] Crude DNA extract (1.5. μl) from hair follicles (prepared as above) or DNA (20-50 n...
example 2
Primer Extension Method
[0144] DNA extracts from hair follicles were prepared using the method described in Example 1. Alternatively, genomic DNA isolated by other methods can be used at a concentration at about 2.5 ng / μl.
[0145] A DNA sample (1 μl) from each of 96 animals was placed into a 96 well PCR microtitre plate (or alternatively, from each of 384 animals into a 384 well PCR plate).
[0146] For the 96 well plate, a cocktail of the following reagents was prepared in a 1.5 ml microtube. The cocktail (4 μl) was added to each well in the plate with a repeating pipette.
ReagentVolume μlWater (HPLC grade)22210× Hotstar Taq PCR buffer50containing 15 mM MgCl2HotStar Taq Polymerase (5 U / μl)425 mM MgCl220dNTP 25 mM4Forward and reverse primer mix100Forward: actggattatggactcaaagatttg (SEQ ID NO: 7)Reverse: aaggtgcagattttcaacat (SEQ ID NO: 8)(1 μM each primer)
[0147] PCR was carried out using the following protocol:
1 cycle:95° C. 15 minutes45 cycles:95° C. 20 seconds56° C. 30 seconds72° ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More