Activin receptor-like kinase-1 compositions and methods of use

Inactive Publication Date: 2009-09-10
GENENTECH INC
View PDF14 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0398]The efficacy of the treatment of the invention can be measured by various endpoints commonly used in evaluating neoplastic or non-neoplastic disorders. For example, cancer treatments can be evaluated by, e.g., but not limited to, tumor regression, tumor weight or size shrinkage, time to progression, duration of survival, progression free survival, overall response rate, duration of response, and quality of life. Because the anti-angiogenesis agents described herein target the tumor vasculature and not necessarily the neoplastic cells themselves, they represent a unique class of anticancer drugs, and therefore can require unique measures and definitions of clinical responses to drugs. For example, tumor shrinkage of greater than 50% in a 2-dimensional analysis is the standard cut-off for declaring a response. However, the inhibitors may cause inhibition of metastatic spread without shrinkage of the primary tumor, or may simply exert a tumouristatic effect. Accordingly, approaches to determining efficacy of the therapy can be employed, including for example, measurement of plasma or urinary markers of angiogenesis and measurement of response through radiological imaging.
[0399]The following examples are provided for illustrative purposes only and are not to be construed as limiting upon the teachings herein.

Problems solved by technology

Treatment with an ALK-1 antagonist resulted in enhanced endothelial cell sprouting, disorganized pericytes, and improper vascular development including tumor and lymphatic vasculature.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Activin receptor-like kinase-1 compositions and methods of use
  • Activin receptor-like kinase-1 compositions and methods of use
  • Activin receptor-like kinase-1 compositions and methods of use

Examples

Experimental program
Comparison scheme
Effect test

example 1

Generation of an ALK1.Fc Molecule

[0400]Using standard molecular biology techniques, an ALK1.Fc molecule was generated by attaching the extracellular domain of ALK-1 (amino acid residues 1-118 of human ALK-1) to the Fc region of human IgG1 via a polypeptide linker. Briefly, an extracellular fragment of human ALK-1 (amino acid 1-118) was subcloned into a pRK5 vector that had been engineered for the expression of fusion protein with a C-terminal Fc of human IgG1. ALK1.Fc was purified with Protein-A affinity chromatography from conditioned medium harvested from serum-free culture of CHO cells transiently transfected with the expression plasmid. The ALK1.Fc molecule had the following cDNA and amino acid sequences:

ALK1.Fc cDNA sequence:(SEQ ID NO: 1)ATGACCTTGGGCTCCCCCAGGAAAGGCCTTCTGATGCTGCTGATGGCCTTGGTGACCCAGGGAGACCCTGTGAAGCCGTCTCGGGGCCCGCTGGTGACCTGCACGTGTGAGAGCCCACATTGCAAGGGGCCTACCTGCCGGGGGGCCTGGTGCACAGTAGTGCTGGTGCGGGAGGAGGGGAGGCACCCCCAGGAACATCGGGGCTGCGGGAACTTGCACAGGGAGCTCTGCAGGGGGCGCCCC...

example 2

Treatment with ALK1.Fc Enhances Endothelial Cell Sprouting In Vitro

[0401]The effect of inhibiting ALK-1 signalling on endothelial cell growth was explored using the HUVEC fibrin gel bead assay. Details of the HUVEC fibrin gel bead assay have been previously described (Nakatsu, Minn., Microvascular Research 44:102-112 (2003)). Briefly, Cytodex 3 beads (Amersham Pharmacia Biotech) were coated with 350-400 human umbilical vein endothelia cells (HUVECs) per bead in 2 ml EGM-2 medium (Clonetics). About 200 LUVECs-coated beads were imbedded in fibrin clot in one well of 12-well tissue culture plate. 80×103 D551 human fibroblast cells were plated on top of the clot and medium was changed every 2 days. ALK1.Fc was added to the culture medium at 5 ug / ml. Phase-contrast microscopy images were taken on day 9.

[0402]HUVECs growing in fibrin gels in the presence of co-cultured human fibroblast cells generate sprouts with a distinct lumen-like structure (Nakatsu, M. N. et al. Microvasc Res 66, 102...

example 3

Treatment with ALK1-Fc Affects Retinal Vascular Development In Vivo

[0403]Neonatal SD rats from the same litters were used to study the effect of ALK1.Fc on retinal vascular development. Rats were injected i.p. with ALK1.Fc (10 mg / kg body weight) on postnatal day 4 (P4), P6 and P9. On P11, rats were anesthetized with Isoflurane. FITC-labeled Lycopersicon Esculentum Lectin (150 μg in 150 μl of 0.9% NaCl; Vector Laboratories) was injected intracardially and allowed to circulate for 3 min. Eyes were collected and fixed with 4% PFA in PBS overnight, followed by PBS washes. The dissected retinas were blocked with 10% goat serum in PBST (PBS, 0.5% Triton X-100) for 3 hrs, then incubated overnight with biotinylated isolectin B4 (1:100, Bandeiraea simplicifolia; Molecular Probe) or Cy3-conjugated anti-alpha smooth muscle actin (ASMA, 1:200, Sigma-Aldrich), with 10% goat serum in PBST. To visualize the biotynylated isolectin B4, retinas were then washed 4 times in PBST, and incubated overnigh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Inhibitionaaaaaaaaaa
Login to View More

Abstract

Disclosed herein are methods and compositions for treating disorders associated with angiogenesis or lymphangiogenesis using ALK-1 antagonists.

Description

RELATED APPLICATION[0001]This application claims priority to U.S. provisional application Ser. Nos. 60 / 986,876 filed on Nov. 9, 2007 and 61 / 098,557 filed on Sep. 19, 2008, the entire contents of which are incorporated herein by reference.FIELD OF THE INVENTION[0002]The present invention concerns methods and compositions relating to the use of activin receptor-like kinase-1 (ALK-1) antagonists for the treatment of disorders associated with angiogenesis and / or lymphangiogenesis.BACKGROUND OF THE INVENTION[0003]Development of a vascular supply is a fundamental requirement for many physiological and pathological processes. Actively growing tissues such as embryos and tumors require adequate blood supply. They satisfy this need by producing pro-angiogenic factors, which promote new blood vessel formation via a process called angiogenesis. Vascular tube formation is a complex but orderly biological event involving all or many of the following steps: a) Endothelial cells (ECs) proliferate ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/395C12N9/12C07K16/40
CPCA61K39/39558C07K2319/30A61K2300/00A61P17/06A61P19/02A61P27/02A61P29/00A61P35/00A61P35/04A61P37/00A61P43/00A61P9/00A61P3/10A61K39/3955A61K2039/505C07K16/40C07K19/00
InventorYAN, MINHONGZHANG, GU
OwnerGENENTECH INC